\
| Variant ID: vg0221479912 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21479912 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )
TCAAGGTCTTAATCAATGTTCATCATTGCCTAAATATAAAAGTTCAACAATATTCATTATTTTAGTTTAAGCCTAAACATTCCTTTGGGGTTAATTATTT[C/T]
GCGGAGGATGAAGCCGGCTATCTCCTCACGAATCTCCTCAAAGTTGGTAGGCAGAGACTTGGTAATTTTGCCCTACATTGTCATAATTCAAGATTAGTTG
CAACTAATCTTGAATTATGACAATGTAGGGCAAAATTACCAAGTCTCTGCCTACCAACTTTGAGGAGATTCGTGAGGAGATAGCCGGCTTCATCCTCCGC[G/A]
AAATAATTAACCCCAAAGGAATGTTTAGGCTTAAACTAAAATAATGAATATTGTTGAACTTTTATATTTAGGCAATGATGAACATTGATTAAGACCTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 1.40% | 1.29% | 0.00% | NA |
| All Indica | 2759 | 95.30% | 2.50% | 2.21% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 0.80% | 4.03% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 6.00% | 4.33% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221479912 | C -> T | LOC_Os02g35760.1 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:41.954; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0221479912 | C -> T | LOC_Os02g35760.2 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:41.954; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0221479912 | C -> T | LOC_Os02g35750.2 | downstream_gene_variant ; 4444.0bp to feature; MODIFIER | silent_mutation | Average:41.954; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0221479912 | C -> T | LOC_Os02g35750.3 | downstream_gene_variant ; 4279.0bp to feature; MODIFIER | silent_mutation | Average:41.954; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0221479912 | C -> T | LOC_Os02g35760-LOC_Os02g35770 | intergenic_region ; MODIFIER | silent_mutation | Average:41.954; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221479912 | 5.53E-07 | 5.53E-07 | mr1449 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221479912 | NA | 8.41E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221479912 | NA | 3.60E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221479912 | NA | 6.67E-09 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221479912 | NA | 2.27E-07 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |