\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221380162:

Variant ID: vg0221380162 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 21380162
Reference Allele: CAGAlternative Allele: GAG,CAGAG,C
Primary Allele: GAGSecondary Allele: CAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCGCGGAAACCGCTACGGCACAACGCATCGGAGGCAGATATGGTGTGTGCATGCATTTGCTTGACTACCAGTCCACCACCAACCTCTCCCCTACACA[CAG/GAG,CAGAG,C]
AGAGAGAGAGAGTGTGTGTGTTTTTGTGTGAGGACCGCCTCCTGTGCAGCTCTTCTTCCAGGGTACTACTCCATTTTGCTGCATGTAGGTACATTCATGT

Reverse complement sequence

ACATGAATGTACCTACATGCAGCAAAATGGAGTAGTACCCTGGAAGAAGAGCTGCACAGGAGGCGGTCCTCACACAAAAACACACACACTCTCTCTCTCT[CTG/CTC,CTCTG,G]
TGTGTAGGGGAGAGGTTGGTGGTGGACTGGTAGTCAAGCAAATGCATGCACACACCATATCTGCCTCCGATGCGTTGTGCCGTAGCGGTTTCCGCGGGAG

Allele Frequencies:

Populations Population SizeFrequency of GAG(primary allele) Frequency of CAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 32.80% 1.02% 0.00% CAGAG: 0.72%
All Indica  2759 96.70% 2.00% 0.25% 0.00% CAGAG: 1.05%
All Japonica  1512 5.80% 91.50% 2.38% 0.00% CAGAG: 0.33%
Aus  269 97.80% 1.50% 0.74% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 95.20% 1.60% 0.11% 0.00% CAGAG: 3.07%
Indica Intermediate  786 96.60% 2.80% 0.51% 0.00% CAGAG: 0.13%
Temperate Japonica  767 6.10% 90.60% 3.13% 0.00% CAGAG: 0.13%
Tropical Japonica  504 3.80% 94.20% 1.19% 0.00% CAGAG: 0.79%
Japonica Intermediate  241 9.10% 88.40% 2.49% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221380162 CAG -> GAG LOC_Os02g35540.1 upstream_gene_variant ; 3878.0bp to feature; MODIFIER silent_mutation Average:93.017; most accessible tissue: Zhenshan97 panicle, score: 98.216 N N N N
vg0221380162 CAG -> GAG LOC_Os02g35540-LOC_Os02g35560 intergenic_region ; MODIFIER silent_mutation Average:93.017; most accessible tissue: Zhenshan97 panicle, score: 98.216 N N N N
vg0221380162 CAG -> CAGAG LOC_Os02g35540.1 upstream_gene_variant ; 3881.0bp to feature; MODIFIER silent_mutation Average:93.017; most accessible tissue: Zhenshan97 panicle, score: 98.216 N N N N
vg0221380162 CAG -> CAGAG LOC_Os02g35540-LOC_Os02g35560 intergenic_region ; MODIFIER silent_mutation Average:93.017; most accessible tissue: Zhenshan97 panicle, score: 98.216 N N N N
vg0221380162 CAG -> C LOC_Os02g35540.1 upstream_gene_variant ; 3879.0bp to feature; MODIFIER N Average:93.017; most accessible tissue: Zhenshan97 panicle, score: 98.216 N N N N
vg0221380162 CAG -> C LOC_Os02g35540-LOC_Os02g35560 intergenic_region ; MODIFIER N Average:93.017; most accessible tissue: Zhenshan97 panicle, score: 98.216 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221380162 CAG C 0.16 0.07 0.13 0.16 -0.03 -0.06
vg0221380162 CAG CAGAG 0.07 -0.01 0.04 0.13 -0.04 -0.1
vg0221380162 CAG GAG -0.02 -0.01 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221380162 7.35E-06 9.80E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 2.20E-06 NA mr1015 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 1.92E-37 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 7.21E-06 7.21E-06 mr1105 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 5.84E-06 NA mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 3.79E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 1.90E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 1.42E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 3.87E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 1.99E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 6.63E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 3.19E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 3.54E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 6.56E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 1.84E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221380162 NA 1.84E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251