Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0220985543:

Variant ID: vg0220985543 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20985543
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTCATAATTGTGGGGTGATATTCTAGACTTTTCGAGTACTCACAAGACCTATAGTCCTAGACAAGGGATGAGAGAGAGACGAGGGTATAAGAGAACAT[C/T]
GTGAGAATGCGCATGAACAATTTATAGTACGAACCCATGGTATGTTACCGTTTACCATCCAAGCAACCATGATCTTAATTAACATGCACAATAAAAAACA

Reverse complement sequence

TGTTTTTTATTGTGCATGTTAATTAAGATCATGGTTGCTTGGATGGTAAACGGTAACATACCATGGGTTCGTACTATAAATTGTTCATGCGCATTCTCAC[G/A]
ATGTTCTCTTATACCCTCGTCTCTCTCTCATCCCTTGTCTAGGACTATAGGTCTTGTGAGTACTCGAAAAGTCTAGAATATCACCCCACAATTATGAGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	23.30%	0.19%	0.08%	NA
All Indica	2759	64.60%	35.00%	0.25%	0.14%	NA
All Japonica	1512	94.90%	5.10%	0.00%	0.00%	NA
Aus	269	81.80%	17.80%	0.37%	0.00%	NA
Indica I	595	80.50%	19.00%	0.17%	0.34%	NA
Indica II	465	63.00%	36.60%	0.43%	0.00%	NA
Indica III	913	52.90%	46.80%	0.11%	0.22%	NA
Indica Intermediate	786	66.90%	32.70%	0.38%	0.00%	NA
Temperate Japonica	767	94.10%	5.90%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220985543	C -> T	LOC_Os02g34990.1	upstream_gene_variant ; 4130.0bp to feature; MODIFIER	silent_mutation	Average:82.897; most accessible tissue: Zhenshan97 flower, score: 92.433	N	N	N	N
vg0220985543	C -> T	LOC_Os02g34990.2	upstream_gene_variant ; 380.0bp to feature; MODIFIER	silent_mutation	Average:82.897; most accessible tissue: Zhenshan97 flower, score: 92.433	N	N	N	N
vg0220985543	C -> T	LOC_Os02g34980.1	downstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:82.897; most accessible tissue: Zhenshan97 flower, score: 92.433	N	N	N	N
vg0220985543	C -> T	LOC_Os02g34980-LOC_Os02g34990	intergenic_region ; MODIFIER	silent_mutation	Average:82.897; most accessible tissue: Zhenshan97 flower, score: 92.433	N	N	N	N
vg0220985543	C -> DEL	N	N	silent_mutation	Average:82.897; most accessible tissue: Zhenshan97 flower, score: 92.433	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0220985543	C	T	-0.02	-0.02	-0.03	0.0	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220985543	5.69E-06	5.69E-06	mr1098	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	3.12E-08	3.12E-08	mr1099	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	6.39E-08	7.97E-08	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	1.41E-06	1.29E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	3.54E-06	3.54E-06	mr1146	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	1.24E-07	1.80E-07	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	4.23E-06	5.77E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	1.79E-06	9.15E-07	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	5.47E-06	2.91E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	5.47E-06	2.91E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	3.67E-06	1.47E-07	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	NA	7.88E-06	mr1099_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220985543	9.28E-06	5.85E-07	mr1150_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251