| Variant ID: vg0220849802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20849802 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAAAGTTCTTTAAGTTCACCAGGTAACCTAGTTCTTGAGGAATGTGTCCATAAAGTTGGTTTTCAAAAAGTGACAAGTCAATGAGTTTAGTCAAATTC[C/T]
CTAAGTTGTTTGGAATAGAACCTGTGAGCATGTTTTTGAAAAGTTCTAAATTCTCTAAATTCACTAGCTTACCTAGTTCTTGAGAAATATGACCAGAAAA
TTTTCTGGTCATATTTCTCAAGAACTAGGTAAGCTAGTGAATTTAGAGAATTTAGAACTTTTCAAAAACATGCTCACAGGTTCTATTCCAAACAACTTAG[G/A]
GAATTTGACTAAACTCATTGACTTGTCACTTTTTGAAAACCAACTTTATGGACACATTCCTCAAGAACTAGGTTACCTGGTGAACTTAAAGAACTTTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 5.70% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.70% | 14.20% | 1.12% | 0.00% | NA |
| Aus | 269 | 94.40% | 3.70% | 1.86% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 76.70% | 21.40% | 1.96% | 0.00% | NA |
| Tropical Japonica | 504 | 91.50% | 8.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220849802 | C -> T | LOC_Os02g34750.1 | upstream_gene_variant ; 3588.0bp to feature; MODIFIER | silent_mutation | Average:28.626; most accessible tissue: Callus, score: 44.693 | N | N | N | N |
| vg0220849802 | C -> T | LOC_Os02g34750.2 | upstream_gene_variant ; 3588.0bp to feature; MODIFIER | silent_mutation | Average:28.626; most accessible tissue: Callus, score: 44.693 | N | N | N | N |
| vg0220849802 | C -> T | LOC_Os02g34760.1 | downstream_gene_variant ; 1809.0bp to feature; MODIFIER | silent_mutation | Average:28.626; most accessible tissue: Callus, score: 44.693 | N | N | N | N |
| vg0220849802 | C -> T | LOC_Os02g34780.1 | downstream_gene_variant ; 3050.0bp to feature; MODIFIER | silent_mutation | Average:28.626; most accessible tissue: Callus, score: 44.693 | N | N | N | N |
| vg0220849802 | C -> T | LOC_Os02g34770.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.626; most accessible tissue: Callus, score: 44.693 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220849802 | 2.09E-06 | 2.09E-06 | mr1099 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220849802 | NA | 6.47E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220849802 | NA | 4.59E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220849802 | 3.44E-07 | 3.43E-07 | mr1868 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |