Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220716138:

Variant ID: vg0220716138 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20716138
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTATTCGGTTCCTGTCCCAAGATCGAGTCTGTGAATATACAAATATGATTTTTTTACTACATTCTTACACCCACTCTTTTTTTCAAGTTCTAGCATCCGT[T/G]
TGTGAATATGACCTACTCCTGCAAATTCATAAACTCGGTGTTGCATATTCTTAGACCCGATCTTGTAGCAAGAACTGAGTAGTTCGTTAACTCGCTACGC

Reverse complement sequence

GCGTAGCGAGTTAACGAACTACTCAGTTCTTGCTACAAGATCGGGTCTAAGAATATGCAACACCGAGTTTATGAATTTGCAGGAGTAGGTCATATTCACA[A/C]
ACGGATGCTAGAACTTGAAAAAAAGAGTGGGTGTAAGAATGTAGTAAAAAAATCATATTTGTATATTCACAGACTCGATCTTGGGACAGGAACCGAATAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	13.00%	0.95%	0.55%	NA
All Indica	2759	83.00%	15.90%	0.91%	0.18%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	27.50%	57.20%	7.43%	7.81%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	72.70%	25.80%	1.51%	0.00%	NA
Indica III	913	80.10%	18.30%	1.31%	0.33%	NA
Indica Intermediate	786	81.40%	17.60%	0.76%	0.25%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220716138	T -> G	LOC_Os02g34550.1	downstream_gene_variant ; 919.0bp to feature; MODIFIER	silent_mutation	Average:40.289; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0220716138	T -> G	LOC_Os02g34560.1	downstream_gene_variant ; 1749.0bp to feature; MODIFIER	silent_mutation	Average:40.289; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0220716138	T -> G	LOC_Os02g34560.2	downstream_gene_variant ; 1749.0bp to feature; MODIFIER	silent_mutation	Average:40.289; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0220716138	T -> G	LOC_Os02g34550-LOC_Os02g34560	intergenic_region ; MODIFIER	silent_mutation	Average:40.289; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0220716138	T -> DEL	N	N	silent_mutation	Average:40.289; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220716138	NA	9.55E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	6.86E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	5.84E-18	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	5.95E-07	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	7.42E-09	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	3.61E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	2.04E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	1.88E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	2.23E-07	3.24E-10	mr1347	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	4.15E-07	mr1351	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	7.00E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	2.45E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	1.13E-07	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	7.35E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	8.17E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	1.19E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	8.22E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	2.14E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220716138	NA	3.06E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251