Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220461014:

Variant ID: vg0220461014 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20461014
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGTCAAACAAGATGACAAAAGCACAGTGCAAAATAGCGGCGTCCGTATAGATGCATTCCAGGATCAAGTTGGGTCAAACACATACTACGGTCGCATTGA[A/G]
GAGATCTGGGAGCTAAACTACGCCAAGTTCAAGGTTCCTTTGTTCCACTGCCGTTGGGTGAATCTACGCACTGGTGTCAAAGCCGACAAGGAAGGTTTCA

Reverse complement sequence

TGAAACCTTCCTTGTCGGCTTTGACACCAGTGCGTAGATTCACCCAACGGCAGTGGAACAAAGGAACCTTGAACTTGGCGTAGTTTAGCTCCCAGATCTC[T/C]
TCAATGCGACCGTAGTATGTGTTTGACCCAACTTGATCCTGGAATGCATCTATACGGACGCCGCTATTTTGCACTGTGCTTTTGTCATCTTGTTTGACGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.70%	1.20%	36.46%	23.64%	NA
All Indica	2759	6.20%	2.10%	57.16%	34.54%	NA
All Japonica	1512	98.40%	0.00%	0.66%	0.93%	NA
Aus	269	5.90%	0.00%	45.35%	48.70%	NA
Indica I	595	3.50%	0.50%	50.08%	45.88%	NA
Indica II	465	10.80%	0.90%	37.20%	51.18%	NA
Indica III	913	5.00%	4.20%	76.23%	14.57%	NA
Indica Intermediate	786	7.00%	1.50%	52.16%	39.31%	NA
Temperate Japonica	767	99.00%	0.00%	0.26%	0.78%	NA
Tropical Japonica	504	98.60%	0.00%	0.79%	0.60%	NA
Japonica Intermediate	241	96.30%	0.00%	1.66%	2.07%	NA
VI/Aromatic	96	95.80%	0.00%	2.08%	2.08%	NA
Intermediate	90	67.80%	0.00%	13.33%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220461014	A -> G	LOC_Os02g34200.1	synonymous_variant ; p.Glu597Glu; LOW	synonymous_codon	Average:27.135; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N
vg0220461014	A -> DEL	LOC_Os02g34200.1	N	frameshift_variant	Average:27.135; most accessible tissue: Minghui63 flag leaf, score: 55.781	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220461014	NA	2.98E-06	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	1.01E-08	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	1.30E-10	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	2.97E-09	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	4.88E-07	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	1.88E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	1.11E-06	3.14E-07	mr1425_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	8.86E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	4.77E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	6.97E-10	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	3.46E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220461014	NA	6.27E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251