\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219876906:

Variant ID: vg0219876906 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19876906
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTGTTAAGTCTCAGCAGTACATCACAAAACACAATCTATGGAATAAATTATCTATGTTTATTCCAATGCATGAAAAAAATATTCTTACGTAACTTTA[T/G]
ATTTGCATAACAAATATTTTTTAAAACAATAACGGACAAACACCATGGTATTTACTATTCATTGCTTAAAAAAGGAATCCATGGTATTTCAGTCACAAAA

Reverse complement sequence

TTTTGTGACTGAAATACCATGGATTCCTTTTTTAAGCAATGAATAGTAAATACCATGGTGTTTGTCCGTTATTGTTTTAAAAAATATTTGTTATGCAAAT[A/C]
TAAAGTTACGTAAGAATATTTTTTTCATGCATTGGAATAAACATAGATAATTTATTCCATAGATTGTGTTTTGTGATGTACTGCTGAGACTTAACAATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.20% 22.70% 2.18% 50.93% NA
All Indica  2759 8.50% 5.40% 2.32% 83.83% NA
All Japonica  1512 51.70% 44.50% 2.18% 1.65% NA
Aus  269 34.60% 49.40% 1.12% 14.87% NA
Indica I  595 7.20% 8.40% 1.34% 83.03% NA
Indica II  465 15.10% 2.40% 4.30% 78.28% NA
Indica III  913 4.90% 2.50% 2.30% 90.25% NA
Indica Intermediate  786 9.70% 8.10% 1.91% 80.28% NA
Temperate Japonica  767 40.50% 55.10% 3.26% 1.04% NA
Tropical Japonica  504 77.60% 20.40% 0.60% 1.39% NA
Japonica Intermediate  241 32.80% 61.00% 2.07% 4.15% NA
VI/Aromatic  96 3.10% 93.80% 0.00% 3.12% NA
Intermediate  90 35.60% 32.20% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219876906 T -> G LOC_Os02g33430.1 upstream_gene_variant ; 3599.0bp to feature; MODIFIER silent_mutation Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0219876906 T -> G LOC_Os02g33440.1 downstream_gene_variant ; 1397.0bp to feature; MODIFIER silent_mutation Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0219876906 T -> G LOC_Os02g33430-LOC_Os02g33440 intergenic_region ; MODIFIER silent_mutation Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0219876906 T -> DEL N N silent_mutation Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219876906 NA 1.83E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 2.34E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 2.11E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 7.52E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 2.59E-11 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 2.79E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 3.10E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 8.10E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 4.93E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.22E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 4.99E-06 1.52E-13 mr1379 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.34E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 9.68E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.13E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.76E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 8.32E-11 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 4.93E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 7.65E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 8.61E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 4.07E-06 4.07E-06 mr1866 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.10E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 3.62E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.08E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 1.83E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906 NA 8.65E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251