Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219876906:

Variant ID: vg0219876906 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19876906
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTGTTAAGTCTCAGCAGTACATCACAAAACACAATCTATGGAATAAATTATCTATGTTTATTCCAATGCATGAAAAAAATATTCTTACGTAACTTTA[T/G]
ATTTGCATAACAAATATTTTTTAAAACAATAACGGACAAACACCATGGTATTTACTATTCATTGCTTAAAAAAGGAATCCATGGTATTTCAGTCACAAAA

Reverse complement sequence

TTTTGTGACTGAAATACCATGGATTCCTTTTTTAAGCAATGAATAGTAAATACCATGGTGTTTGTCCGTTATTGTTTTAAAAAATATTTGTTATGCAAAT[A/C]
TAAAGTTACGTAAGAATATTTTTTTCATGCATTGGAATAAACATAGATAATTTATTCCATAGATTGTGTTTTGTGATGTACTGCTGAGACTTAACAATTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.20%	22.70%	2.18%	50.93%	NA
All Indica	2759	8.50%	5.40%	2.32%	83.83%	NA
All Japonica	1512	51.70%	44.50%	2.18%	1.65%	NA
Aus	269	34.60%	49.40%	1.12%	14.87%	NA
Indica I	595	7.20%	8.40%	1.34%	83.03%	NA
Indica II	465	15.10%	2.40%	4.30%	78.28%	NA
Indica III	913	4.90%	2.50%	2.30%	90.25%	NA
Indica Intermediate	786	9.70%	8.10%	1.91%	80.28%	NA
Temperate Japonica	767	40.50%	55.10%	3.26%	1.04%	NA
Tropical Japonica	504	77.60%	20.40%	0.60%	1.39%	NA
Japonica Intermediate	241	32.80%	61.00%	2.07%	4.15%	NA
VI/Aromatic	96	3.10%	93.80%	0.00%	3.12%	NA
Intermediate	90	35.60%	32.20%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219876906	T -> G	LOC_Os02g33430.1	upstream_gene_variant ; 3599.0bp to feature; MODIFIER	silent_mutation	Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0219876906	T -> G	LOC_Os02g33440.1	downstream_gene_variant ; 1397.0bp to feature; MODIFIER	silent_mutation	Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0219876906	T -> G	LOC_Os02g33430-LOC_Os02g33440	intergenic_region ; MODIFIER	silent_mutation	Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0219876906	T -> DEL	N	N	silent_mutation	Average:16.523; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219876906	NA	1.83E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	2.34E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	2.11E-06	mr1085	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	7.52E-06	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	2.59E-11	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	2.79E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	3.10E-07	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	8.10E-06	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	4.93E-10	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.22E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	4.99E-06	1.52E-13	mr1379	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.34E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	9.68E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.13E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.76E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	8.32E-11	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	4.93E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	7.65E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	8.61E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	4.07E-06	4.07E-06	mr1866	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.10E-06	mr1964	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	3.62E-08	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.08E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	1.83E-10	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219876906	NA	8.65E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251