\
| Variant ID: vg0219846372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19846372 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGTTGAAATGATTTGAAAAAAATGAATAGAGGATTGTAGCAAGGTTCTAGCCGCTCCGCAGCTCTACTCCAAACTATGGTCCTGAGTTAAATTTAGAAG[T/C]
TAGGGCCATACCAAATACTAGAAAAGACTACTTGTGAGGCATTAACAACCCTTGTTTGCTCTTCAACTTTTCTATGCATGTTTTAACGTTTTCTCCAAAA
TTTTGGAGAAAACGTTAAAACATGCATAGAAAAGTTGAAGAGCAAACAAGGGTTGTTAATGCCTCACAAGTAGTCTTTTCTAGTATTTGGTATGGCCCTA[A/G]
CTTCTAAATTTAACTCAGGACCATAGTTTGGAGTAGAGCTGCGGAGCGGCTAGAACCTTGCTACAATCCTCTATTCATTTTTTTCAAATCATTTCAACCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 9.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.70% | 12.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 62.10% | 37.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.20% | 12.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 30.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219846372 | T -> C | LOC_Os02g33400.1 | upstream_gene_variant ; 1204.0bp to feature; MODIFIER | silent_mutation | Average:52.485; most accessible tissue: Callus, score: 72.168 | N | N | N | N |
| vg0219846372 | T -> C | LOC_Os02g33410.1 | downstream_gene_variant ; 1757.0bp to feature; MODIFIER | silent_mutation | Average:52.485; most accessible tissue: Callus, score: 72.168 | N | N | N | N |
| vg0219846372 | T -> C | LOC_Os02g33400-LOC_Os02g33410 | intergenic_region ; MODIFIER | silent_mutation | Average:52.485; most accessible tissue: Callus, score: 72.168 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219846372 | 2.51E-06 | NA | mr1715 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219846372 | NA | 1.19E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219846372 | NA | 1.55E-08 | mr1793_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |