\
| Variant ID: vg0219817547 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19817547 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 92. )
TGTCCAAGATCATATGCTGACTGTACATTCATGCTTTTTTTTTATACATAACTGGACATTCATACTTACTATGTTTCATTTACGCATAGTACTTTATTGC[A/G]
CGAGCAATTTTGAAGTCCTTGTGGAGGTACCACTTTTTCTATTATAAATTTGGTACCTCATAGTACACTAAATTTTTTATACCTCATGATATCTCCTTAA
TTAAGGAGATATCATGAGGTATAAAAAATTTAGTGTACTATGAGGTACCAAATTTATAATAGAAAAAGTGGTACCTCCACAAGGACTTCAAAATTGCTCG[T/C]
GCAATAAAGTACTATGCGTAAATGAAACATAGTAAGTATGAATGTCCAGTTATGTATAAAAAAAAAGCATGAATGTACAGTCAGCATATGATCTTGGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 47.10% | 0.08% | 0.51% | NA |
| All Indica | 2759 | 85.80% | 13.50% | 0.11% | 0.54% | NA |
| All Japonica | 1512 | 1.70% | 98.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 18.60% | 81.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.50% | 17.50% | 0.17% | 0.84% | NA |
| Indica II | 465 | 83.00% | 16.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 92.90% | 6.90% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 82.60% | 16.50% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 1.20% | 98.40% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 1.60% | 98.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 60.00% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219817547 | A -> G | LOC_Os02g33360.1 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:51.418; most accessible tissue: Callus, score: 85.372 | N | N | N | N |
| vg0219817547 | A -> G | LOC_Os02g33340-LOC_Os02g33360 | intergenic_region ; MODIFIER | silent_mutation | Average:51.418; most accessible tissue: Callus, score: 85.372 | N | N | N | N |
| vg0219817547 | A -> DEL | N | N | silent_mutation | Average:51.418; most accessible tissue: Callus, score: 85.372 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219817547 | NA | 7.69E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 3.67E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 2.85E-31 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 6.87E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 6.60E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 3.96E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 1.44E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 4.17E-33 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 1.11E-20 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 1.44E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 2.33E-17 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 1.33E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 3.46E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 7.24E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | 3.98E-07 | NA | mr1707_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | 3.33E-06 | NA | mr1707_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | NA | 6.50E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | 3.58E-06 | NA | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219817547 | 1.42E-06 | NA | mr1860_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |