\
| Variant ID: vg0219806820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19806820 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCTCACCGTGCATGGCAGAGAGAGAGAGGGGCATGTGGCCTTGCAAGGGAGAATGATAGGCACGGTTCAGGATAGGAGCGAATATGAAGGGGAGAAGAG[C/T]
GACATGTGCATGAAGATAAGGACGCATGAGGGAATAAGGACATGATTTTTTTCTTTCTCATGCTCCACGCCCGTCGGCTCGGCTCGGTTTGATGGAGTGT
ACACTCCATCAAACCGAGCCGAGCCGACGGGCGTGGAGCATGAGAAAGAAAAAAATCATGTCCTTATTCCCTCATGCGTCCTTATCTTCATGCACATGTC[G/A]
CTCTTCTCCCCTTCATATTCGCTCCTATCCTGAACCGTGCCTATCATTCTCCCTTGCAAGGCCACATGCCCCTCTCTCTCTCTGCCATGCACGGTGAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 9.70% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 70.60% | 28.80% | 0.66% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.60% | 4.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 28.00% | 70.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219806820 | C -> T | LOC_Os02g33335.1 | upstream_gene_variant ; 4647.0bp to feature; MODIFIER | silent_mutation | Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383 | N | N | N | N |
| vg0219806820 | C -> T | LOC_Os02g33340.1 | upstream_gene_variant ; 1102.0bp to feature; MODIFIER | silent_mutation | Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383 | N | N | N | N |
| vg0219806820 | C -> T | LOC_Os02g33335-LOC_Os02g33340 | intergenic_region ; MODIFIER | silent_mutation | Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219806820 | NA | 3.13E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 8.84E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 5.87E-29 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 6.16E-10 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 3.00E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 7.96E-11 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 3.01E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 1.17E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 3.36E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 4.30E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 3.13E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 1.73E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 1.47E-34 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | 2.94E-07 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 7.22E-09 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 4.89E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219806820 | NA | 9.43E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |