\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219806820:

Variant ID: vg0219806820 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19806820
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTCACCGTGCATGGCAGAGAGAGAGAGGGGCATGTGGCCTTGCAAGGGAGAATGATAGGCACGGTTCAGGATAGGAGCGAATATGAAGGGGAGAAGAG[C/T]
GACATGTGCATGAAGATAAGGACGCATGAGGGAATAAGGACATGATTTTTTTCTTTCTCATGCTCCACGCCCGTCGGCTCGGCTCGGTTTGATGGAGTGT

Reverse complement sequence

ACACTCCATCAAACCGAGCCGAGCCGACGGGCGTGGAGCATGAGAAAGAAAAAAATCATGTCCTTATTCCCTCATGCGTCCTTATCTTCATGCACATGTC[G/A]
CTCTTCTCCCCTTCATATTCGCTCCTATCCTGAACCGTGCCTATCATTCTCCCTTGCAAGGCCACATGCCCCTCTCTCTCTCTGCCATGCACGGTGAGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.70% 0.44% 0.00% NA
All Indica  2759 99.50% 0.30% 0.22% 0.00% NA
All Japonica  1512 70.60% 28.80% 0.66% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 95.60% 4.20% 0.26% 0.00% NA
Tropical Japonica  504 28.00% 70.40% 1.59% 0.00% NA
Japonica Intermediate  241 80.10% 19.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219806820 C -> T LOC_Os02g33335.1 upstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0219806820 C -> T LOC_Os02g33340.1 upstream_gene_variant ; 1102.0bp to feature; MODIFIER silent_mutation Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0219806820 C -> T LOC_Os02g33335-LOC_Os02g33340 intergenic_region ; MODIFIER silent_mutation Average:62.715; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219806820 NA 3.13E-08 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 8.84E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 5.87E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 6.16E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 3.00E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 7.96E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 3.01E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 1.17E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 3.36E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 4.30E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 3.13E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 1.73E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 1.47E-34 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 2.94E-07 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 7.22E-09 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 4.89E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219806820 NA 9.43E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251