Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219199169:

Variant ID: vg0219199169 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19199169
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTGCTTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGACGCGACTACACGTC[G/A]
GTCGCCCGATGGAGAGCAGGGGAAATCAGGCGCTGACGTCAGCATGACATCAGCGCCCGATTTACGTGCAAAACTATTTTAAACTGATTTTTCTCTTAAA

Reverse complement sequence

TTTAAGAGAAAAATCAGTTTAAAATAGTTTTGCACGTAAATCGGGCGCTGATGTCATGCTGACGTCAGCGCCTGATTTCCCCTGCTCTCCATCGGGCGAC[C/T]
GACGTGTAGTCGCGTCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAAGCAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	35.70%	0.30%	4.51%	NA
All Indica	2759	82.10%	17.00%	0.25%	0.72%	NA
All Japonica	1512	30.20%	58.30%	0.26%	11.24%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	63.90%	36.10%	0.00%	0.00%	NA
Indica II	465	92.70%	7.10%	0.22%	0.00%	NA
Indica III	913	92.20%	5.80%	0.11%	1.86%	NA
Indica Intermediate	786	77.70%	21.20%	0.64%	0.38%	NA
Temperate Japonica	767	49.90%	46.00%	0.00%	4.04%	NA
Tropical Japonica	504	6.20%	75.40%	0.60%	17.86%	NA
Japonica Intermediate	241	17.80%	61.40%	0.41%	20.33%	NA
VI/Aromatic	96	2.10%	77.10%	1.04%	19.79%	NA
Intermediate	90	56.70%	36.70%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219199169	G -> A	LOC_Os02g32465.1	upstream_gene_variant ; 2800.0bp to feature; MODIFIER	silent_mutation	Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0219199169	G -> A	LOC_Os02g32460.1	downstream_gene_variant ; 2042.0bp to feature; MODIFIER	silent_mutation	Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0219199169	G -> A	LOC_Os02g32469.1	downstream_gene_variant ; 3617.0bp to feature; MODIFIER	silent_mutation	Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0219199169	G -> A	LOC_Os02g32469.2	downstream_gene_variant ; 3617.0bp to feature; MODIFIER	silent_mutation	Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0219199169	G -> A	LOC_Os02g32460-LOC_Os02g32465	intergenic_region ; MODIFIER	silent_mutation	Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0219199169	G -> DEL	N	N	silent_mutation	Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219199169	NA	5.81E-22	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0219199169	NA	1.09E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	2.18E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	7.94E-12	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	3.15E-16	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	3.63E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	1.38E-09	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	5.07E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	2.52E-06	NA	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	3.96E-10	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	1.58E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	1.30E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	1.45E-21	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	4.34E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	7.48E-14	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	1.73E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	9.55E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	5.54E-18	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169	NA	9.65E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251