\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219199169:

Variant ID: vg0219199169 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19199169
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTGCTTTTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGACGCGACTACACGTC[G/A]
GTCGCCCGATGGAGAGCAGGGGAAATCAGGCGCTGACGTCAGCATGACATCAGCGCCCGATTTACGTGCAAAACTATTTTAAACTGATTTTTCTCTTAAA

Reverse complement sequence

TTTAAGAGAAAAATCAGTTTAAAATAGTTTTGCACGTAAATCGGGCGCTGATGTCATGCTGACGTCAGCGCCTGATTTCCCCTGCTCTCCATCGGGCGAC[C/T]
GACGTGTAGTCGCGTCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAAAAGCAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 35.70% 0.30% 4.51% NA
All Indica  2759 82.10% 17.00% 0.25% 0.72% NA
All Japonica  1512 30.20% 58.30% 0.26% 11.24% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 63.90% 36.10% 0.00% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 92.20% 5.80% 0.11% 1.86% NA
Indica Intermediate  786 77.70% 21.20% 0.64% 0.38% NA
Temperate Japonica  767 49.90% 46.00% 0.00% 4.04% NA
Tropical Japonica  504 6.20% 75.40% 0.60% 17.86% NA
Japonica Intermediate  241 17.80% 61.40% 0.41% 20.33% NA
VI/Aromatic  96 2.10% 77.10% 1.04% 19.79% NA
Intermediate  90 56.70% 36.70% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219199169 G -> A LOC_Os02g32465.1 upstream_gene_variant ; 2800.0bp to feature; MODIFIER silent_mutation Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0219199169 G -> A LOC_Os02g32460.1 downstream_gene_variant ; 2042.0bp to feature; MODIFIER silent_mutation Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0219199169 G -> A LOC_Os02g32469.1 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0219199169 G -> A LOC_Os02g32469.2 downstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0219199169 G -> A LOC_Os02g32460-LOC_Os02g32465 intergenic_region ; MODIFIER silent_mutation Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0219199169 G -> DEL N N silent_mutation Average:38.893; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219199169 NA 5.81E-22 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0219199169 NA 1.09E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 2.18E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 7.94E-12 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 3.15E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 3.63E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 1.38E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 5.07E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 2.52E-06 NA mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 3.96E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 1.58E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 1.30E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 1.45E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 4.34E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 7.48E-14 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 1.73E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 9.55E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 5.54E-18 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219199169 NA 9.65E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251