\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218787476:

Variant ID: vg0218787476 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18787476
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TACTTTTGTCACCAAAACCAAGAAAATATTAAATCATCTTGGATGTTATAAAATCAAGGAGTAAATGCAAGCATGCAAGTATGCAACCAATGAATATTTA[G/A]
ATGACTCCTCCGGTTCTAATCAAACATTTAATTTATCTCTTCATTTAAGTCTTAAATACATAAAGACTATAAATAGGAACAACTTATTTGGAAAAACTCA

Reverse complement sequence

TGAGTTTTTCCAAATAAGTTGTTCCTATTTATAGTCTTTATGTATTTAAGACTTAAATGAAGAGATAAATTAAATGTTTGATTAGAACCGGAGGAGTCAT[C/T]
TAAATATTCATTGGTTGCATACTTGCATGCTTGCATTTACTCCTTGATTTTATAACATCCAAGATGATTTAATATTTTCTTGGTTTTGGTGACAAAAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 26.30% 3.89% 8.02% NA
All Indica  2759 39.90% 41.00% 6.20% 12.83% NA
All Japonica  1512 97.90% 2.10% 0.07% 0.00% NA
Aus  269 69.10% 20.10% 2.23% 8.55% NA
Indica I  595 57.50% 30.30% 4.20% 8.07% NA
Indica II  465 39.40% 50.80% 4.30% 5.59% NA
Indica III  913 34.90% 37.10% 6.79% 21.14% NA
Indica Intermediate  786 32.80% 48.00% 8.14% 11.07% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 3.70% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 61.10% 30.00% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218787476 G -> A LOC_Os02g31310.1 upstream_gene_variant ; 1732.0bp to feature; MODIFIER silent_mutation Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg0218787476 G -> A LOC_Os02g31320.1 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg0218787476 G -> A LOC_Os02g31310-LOC_Os02g31320 intergenic_region ; MODIFIER silent_mutation Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg0218787476 G -> DEL N N silent_mutation Average:15.046; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218787476 NA 9.48E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 4.70E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 2.33E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 8.32E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 3.02E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 1.02E-07 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 3.16E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 3.89E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 4.26E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 1.64E-22 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 2.54E-10 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 1.36E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 2.62E-14 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 1.51E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 3.72E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 4.60E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 1.61E-06 mr1577_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218787476 NA 1.86E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251