Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218695086:

Variant ID: vg0218695086 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18695086
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATTTCGTAGGATCATGTAGTAATGAGTAGTAGGATCGAGATACTATGAAAATTAGGATACTAGATGGGATTGGTATCGTTTCGGCTTGGTAGGATCGTA[G/T]
TATCGTAAGATACTAGGATATGTATCGGGATACTGACAACCTTGTTTGTACCCTTTTGATCGTATAGAGAATTTTCACTACGCCGGACCAGGTCATCTCT

Reverse complement sequence

AGAGATGACCTGGTCCGGCGTAGTGAAAATTCTCTATACGATCAAAAGGGTACAAACAAGGTTGTCAGTATCCCGATACATATCCTAGTATCTTACGATA[C/A]
TACGATCCTACCAAGCCGAAACGATACCAATCCCATCTAGTATCCTAATTTTCATAGTATCTCGATCCTACTACTCATTACTACATGATCCTACGAAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	5.40%	0.59%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.07%	0.00%	NA
All Japonica	1512	82.50%	15.90%	1.65%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	52.80%	43.10%	4.17%	0.00%	NA
Japonica Intermediate	241	90.50%	7.90%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218695086	G -> T	LOC_Os02g31210.1	upstream_gene_variant ; 1116.0bp to feature; MODIFIER	silent_mutation	Average:40.439; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0218695086	G -> T	LOC_Os02g31200.1	downstream_gene_variant ; 3618.0bp to feature; MODIFIER	silent_mutation	Average:40.439; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0218695086	G -> T	LOC_Os02g31210-LOC_Os02g31220	intergenic_region ; MODIFIER	silent_mutation	Average:40.439; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218695086	NA	9.59E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	1.91E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	2.16E-07	2.16E-07	mr1131	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	5.75E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.64E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	7.24E-07	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	1.46E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.74E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	1.93E-07	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.10E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	1.28E-06	mr1653	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.31E-10	mr1696	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	1.86E-07	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	1.66E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.61E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.31E-10	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	5.29E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	7.99E-10	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	4.70E-08	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	4.76E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	5.75E-06	mr1253_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	4.84E-07	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.48E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	9.82E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	3.60E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	3.55E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	2.11E-08	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218695086	NA	4.80E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251