\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217852863:

Variant ID: vg0217852863 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17852863
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, C: 0.47, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACTTGTCAATTTTCCCAATCTTCTCTCTTTCCTTGTTATTTTTTCATTGCACGGATGACACACGCACACCGCAATCAGACACACACAATGCTCTTAA[C/A]
GAGACGAAGACCAGCGATAAATTTTTGACTTCACTAAATTTCCATTGAAAACGCACTCGCACGTGCATAATATTTATAGACACCAAGATTTAAACCTGAT

Reverse complement sequence

ATCAGGTTTAAATCTTGGTGTCTATAAATATTATGCACGTGCGAGTGCGTTTTCAATGGAAATTTAGTGAAGTCAAAAATTTATCGCTGGTCTTCGTCTC[G/T]
TTAAGAGCATTGTGTGTGTCTGATTGCGGTGTGCGTGTGTCATCCGTGCAATGAAAAAATAACAAGGAAAGAGAGAAGATTGGGAAAATTGACAAGTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.40% 14.80% 0.34% 67.48% NA
All Indica  2759 0.80% 18.90% 0.36% 79.99% NA
All Japonica  1512 51.50% 0.70% 0.26% 47.55% NA
Aus  269 0.00% 55.00% 0.37% 44.61% NA
Indica I  595 1.30% 24.70% 0.34% 73.61% NA
Indica II  465 0.60% 28.60% 0.43% 70.32% NA
Indica III  913 0.50% 10.70% 0.11% 88.61% NA
Indica Intermediate  786 0.60% 18.20% 0.64% 80.53% NA
Temperate Japonica  767 93.40% 0.10% 0.13% 6.39% NA
Tropical Japonica  504 1.40% 1.60% 0.60% 96.43% NA
Japonica Intermediate  241 22.80% 0.80% 0.00% 76.35% NA
VI/Aromatic  96 7.30% 4.20% 0.00% 88.54% NA
Intermediate  90 16.70% 17.80% 1.11% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217852863 C -> A LOC_Os02g30060.1 upstream_gene_variant ; 304.0bp to feature; MODIFIER silent_mutation Average:57.933; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg0217852863 C -> A LOC_Os02g30050.1 downstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:57.933; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg0217852863 C -> A LOC_Os02g30060-LOC_Os02g30070 intergenic_region ; MODIFIER silent_mutation Average:57.933; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg0217852863 C -> DEL N N silent_mutation Average:57.933; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217852863 4.07E-11 1.51E-18 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 2.18E-09 6.38E-17 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 8.96E-08 4.12E-13 mr1608 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 1.31E-07 4.45E-11 mr1608 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 2.76E-07 1.05E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 2.99E-06 5.49E-07 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 9.29E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 2.87E-11 6.02E-53 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 5.80E-07 1.70E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 3.09E-07 7.18E-18 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 2.61E-06 2.04E-08 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 4.18E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 4.06E-06 1.32E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 1.33E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 3.00E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 3.14E-08 6.53E-21 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 8.10E-06 3.61E-16 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 1.30E-08 1.10E-18 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 1.21E-06 4.50E-14 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 1.18E-15 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 3.03E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 1.62E-07 2.96E-22 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 2.83E-12 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 7.97E-15 9.31E-68 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 8.21E-09 1.16E-29 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 5.84E-07 1.13E-23 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 6.31E-12 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 4.67E-08 4.02E-25 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 1.38E-17 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 1.97E-09 4.43E-29 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217852863 NA 1.02E-17 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251