| Variant ID: vg0217679975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17679975 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATTTTGCTTATTTACAACTGCCGATCGATTCAAATATGACATCAGCTCAAAGGTAAATGATATGTCATCGGCGGCTGGCCGATCGGCTATCATTTATGG[G/A]
TTTAACTGCTATTTTCCTATTTTATTTCTTGTTGATTGCAGGTTCAAATCAACTGGCACGCTCACGAACCTAAAAGGCAAGATTTTTGGACCGGCACTGA
TCAGTGCCGGTCCAAAAATCTTGCCTTTTAGGTTCGTGAGCGTGCCAGTTGATTTGAACCTGCAATCAACAAGAAATAAAATAGGAAAATAGCAGTTAAA[C/T]
CCATAAATGATAGCCGATCGGCCAGCCGCCGATGACATATCATTTACCTTTGAGCTGATGTCATATTTGAATCGATCGGCAGTTGTAAATAAGCAAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 0.10% | 0.68% | 47.02% | NA |
| All Indica | 2759 | 29.70% | 0.00% | 0.94% | 69.30% | NA |
| All Japonica | 1512 | 98.60% | 0.10% | 0.07% | 1.19% | NA |
| Aus | 269 | 26.00% | 0.00% | 1.49% | 72.49% | NA |
| Indica I | 595 | 52.40% | 0.00% | 0.84% | 46.72% | NA |
| Indica II | 465 | 35.50% | 0.20% | 0.65% | 63.66% | NA |
| Indica III | 913 | 11.80% | 0.00% | 0.99% | 87.19% | NA |
| Indica Intermediate | 786 | 29.90% | 0.00% | 1.15% | 68.96% | NA |
| Temperate Japonica | 767 | 98.80% | 0.30% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 29.20% | 0.00% | 0.00% | 70.83% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 1.11% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217679975 | G -> A | LOC_Os02g29710.1 | upstream_gene_variant ; 4783.0bp to feature; MODIFIER | silent_mutation | Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 | N | N | N | N |
| vg0217679975 | G -> A | LOC_Os02g29720.1 | upstream_gene_variant ; 1751.0bp to feature; MODIFIER | silent_mutation | Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 | N | N | N | N |
| vg0217679975 | G -> A | LOC_Os02g29730.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 | N | N | N | N |
| vg0217679975 | G -> DEL | N | N | silent_mutation | Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217679975 | 8.80E-06 | 9.06E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217679975 | NA | 4.54E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217679975 | NA | 4.32E-07 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217679975 | 6.24E-07 | NA | mr1257 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217679975 | 2.37E-07 | 4.33E-08 | mr1257 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |