Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0217679975:

Variant ID: vg0217679975 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17679975
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTTGCTTATTTACAACTGCCGATCGATTCAAATATGACATCAGCTCAAAGGTAAATGATATGTCATCGGCGGCTGGCCGATCGGCTATCATTTATGG[G/A]
TTTAACTGCTATTTTCCTATTTTATTTCTTGTTGATTGCAGGTTCAAATCAACTGGCACGCTCACGAACCTAAAAGGCAAGATTTTTGGACCGGCACTGA

Reverse complement sequence

TCAGTGCCGGTCCAAAAATCTTGCCTTTTAGGTTCGTGAGCGTGCCAGTTGATTTGAACCTGCAATCAACAAGAAATAAAATAGGAAAATAGCAGTTAAA[C/T]
CCATAAATGATAGCCGATCGGCCAGCCGCCGATGACATATCATTTACCTTTGAGCTGATGTCATATTTGAATCGATCGGCAGTTGTAAATAAGCAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	0.10%	0.68%	47.02%	NA
All Indica	2759	29.70%	0.00%	0.94%	69.30%	NA
All Japonica	1512	98.60%	0.10%	0.07%	1.19%	NA
Aus	269	26.00%	0.00%	1.49%	72.49%	NA
Indica I	595	52.40%	0.00%	0.84%	46.72%	NA
Indica II	465	35.50%	0.20%	0.65%	63.66%	NA
Indica III	913	11.80%	0.00%	0.99%	87.19%	NA
Indica Intermediate	786	29.90%	0.00%	1.15%	68.96%	NA
Temperate Japonica	767	98.80%	0.30%	0.13%	0.78%	NA
Tropical Japonica	504	98.40%	0.00%	0.00%	1.59%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	29.20%	0.00%	0.00%	70.83%	NA
Intermediate	90	66.70%	0.00%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217679975	G -> A	LOC_Os02g29710.1	upstream_gene_variant ; 4783.0bp to feature; MODIFIER	silent_mutation	Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843	N	N	N	N
vg0217679975	G -> A	LOC_Os02g29720.1	upstream_gene_variant ; 1751.0bp to feature; MODIFIER	silent_mutation	Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843	N	N	N	N
vg0217679975	G -> A	LOC_Os02g29730.1	intron_variant ; MODIFIER	silent_mutation	Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843	N	N	N	N
vg0217679975	G -> DEL	N	N	silent_mutation	Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217679975	8.80E-06	9.06E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975	NA	4.54E-07	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975	NA	4.32E-07	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975	6.24E-07	NA	mr1257	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975	2.37E-07	4.33E-08	mr1257	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251