\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217679975:

Variant ID: vg0217679975 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17679975
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTGCTTATTTACAACTGCCGATCGATTCAAATATGACATCAGCTCAAAGGTAAATGATATGTCATCGGCGGCTGGCCGATCGGCTATCATTTATGG[G/A]
TTTAACTGCTATTTTCCTATTTTATTTCTTGTTGATTGCAGGTTCAAATCAACTGGCACGCTCACGAACCTAAAAGGCAAGATTTTTGGACCGGCACTGA

Reverse complement sequence

TCAGTGCCGGTCCAAAAATCTTGCCTTTTAGGTTCGTGAGCGTGCCAGTTGATTTGAACCTGCAATCAACAAGAAATAAAATAGGAAAATAGCAGTTAAA[C/T]
CCATAAATGATAGCCGATCGGCCAGCCGCCGATGACATATCATTTACCTTTGAGCTGATGTCATATTTGAATCGATCGGCAGTTGTAAATAAGCAAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 0.10% 0.68% 47.02% NA
All Indica  2759 29.70% 0.00% 0.94% 69.30% NA
All Japonica  1512 98.60% 0.10% 0.07% 1.19% NA
Aus  269 26.00% 0.00% 1.49% 72.49% NA
Indica I  595 52.40% 0.00% 0.84% 46.72% NA
Indica II  465 35.50% 0.20% 0.65% 63.66% NA
Indica III  913 11.80% 0.00% 0.99% 87.19% NA
Indica Intermediate  786 29.90% 0.00% 1.15% 68.96% NA
Temperate Japonica  767 98.80% 0.30% 0.13% 0.78% NA
Tropical Japonica  504 98.40% 0.00% 0.00% 1.59% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 29.20% 0.00% 0.00% 70.83% NA
Intermediate  90 66.70% 0.00% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217679975 G -> A LOC_Os02g29710.1 upstream_gene_variant ; 4783.0bp to feature; MODIFIER silent_mutation Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 N N N N
vg0217679975 G -> A LOC_Os02g29720.1 upstream_gene_variant ; 1751.0bp to feature; MODIFIER silent_mutation Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 N N N N
vg0217679975 G -> A LOC_Os02g29730.1 intron_variant ; MODIFIER silent_mutation Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 N N N N
vg0217679975 G -> DEL N N silent_mutation Average:24.311; most accessible tissue: Minghui63 flower, score: 44.843 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217679975 8.80E-06 9.06E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975 NA 4.54E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975 NA 4.32E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975 6.24E-07 NA mr1257 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217679975 2.37E-07 4.33E-08 mr1257 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251