\
| Variant ID: vg0217652051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17652051 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCGGGGACCAGTTCTTCTAAGGATGGAGATGGGAAACAAGCTCCAGACGGCTCGGCTCAGCTGAGTAACAAAAGTGCTACCGACAGCTCTCTAGGAAAT[C/T]
AAGGTGACAATTCTCAAGGAGTCCATGGAGTGCAAGGTGACGGGGTGCATGGAGTTCAAGGTGGTGGTGCCCGAGGGTTGCAAGGAGGGGATCTTAATCA
TGATTAAGATCCCCTCCTTGCAACCCTCGGGCACCACCACCTTGAACTCCATGCACCCCGTCACCTTGCACTCCATGGACTCCTTGAGAATTGTCACCTT[G/A]
ATTTCCTAGAGAGCTGTCGGTAGCACTTTTGTTACTCAGCTGAGCCGAGCCGTCTGGAGCTTGTTTCCCATCTCCATCCTTAGAAGAACTGGTCCCCGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 11.60% | 5.40% | 0.61% | NA |
| All Indica | 2759 | 77.00% | 14.70% | 7.25% | 1.05% | NA |
| All Japonica | 1512 | 99.60% | 0.10% | 0.33% | 0.00% | NA |
| Aus | 269 | 33.80% | 50.90% | 15.24% | 0.00% | NA |
| Indica I | 595 | 85.70% | 1.20% | 11.76% | 1.34% | NA |
| Indica II | 465 | 95.30% | 1.70% | 3.01% | 0.00% | NA |
| Indica III | 913 | 60.70% | 33.30% | 4.27% | 1.75% | NA |
| Indica Intermediate | 786 | 78.50% | 11.10% | 9.80% | 0.64% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217652051 | C -> T | LOC_Os02g29650.1 | stop_gained ; p.Gln117*; HIGH | stop_gained | Average:32.835; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0217652051 | C -> DEL | LOC_Os02g29650.1 | N | frameshift_variant | Average:32.835; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217652051 | NA | 5.30E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | 4.50E-07 | 4.50E-07 | mr1275 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 2.62E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 3.03E-06 | mr1345 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | 1.75E-06 | 1.75E-06 | mr1345 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 1.13E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 7.79E-06 | mr1427 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 2.14E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 6.20E-06 | mr1474 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 6.20E-06 | mr1475 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | 1.93E-06 | 1.93E-06 | mr1700 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 1.64E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | 2.02E-06 | 2.02E-06 | mr1777 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | NA | 4.35E-06 | mr1972 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217652051 | 3.11E-07 | 3.11E-07 | mr1972 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |