\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217157408:

Variant ID: vg0217157408 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17157408
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATAGCCCACTCCATATGAACCATATCCAGGGATTAAATGAGATGTGAGGTCATCATATGACAGATTCACAATCCAGTCATATACGACTCCAACAAAC[G/A]
GGCAAAGGAATAAAAGTAATTAGATCATCCTAAGAAAATGGCCTTTTTAAAGATAACGTCAGTATGGCATATGGTTCTTCAGGCTTCAGAGTAACATTGA

Reverse complement sequence

TCAATGTTACTCTGAAGCCTGAAGAACCATATGCCATACTGACGTTATCTTTAAAAAGGCCATTTTCTTAGGATGATCTAATTACTTTTATTCCTTTGCC[C/T]
GTTTGTTGGAGTCGTATATGACTGGATTGTGAATCTGTCATATGATGACCTCACATCTCATTTAATCCCTGGATATGGTTCATATGGAGTGGGCTATTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 31.10% 0.30% 0.00% NA
All Indica  2759 95.70% 4.30% 0.00% 0.00% NA
All Japonica  1512 12.40% 86.70% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 14.70% 83.80% 1.43% 0.00% NA
Tropical Japonica  504 7.70% 92.10% 0.20% 0.00% NA
Japonica Intermediate  241 14.90% 84.60% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217157408 G -> A LOC_Os02g28970.1 downstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:56.536; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg0217157408 G -> A LOC_Os02g28970.2 downstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:56.536; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg0217157408 G -> A LOC_Os02g28980.1 intron_variant ; MODIFIER silent_mutation Average:56.536; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217157408 NA 1.02E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 4.13E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 1.92E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 4.79E-07 NA mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 7.07E-10 1.76E-12 mr1897 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 1.99E-06 1.99E-06 mr1927 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 4.60E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 7.84E-07 NA mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 1.17E-06 1.17E-06 mr1317_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 1.22E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 1.83E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 1.10E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 NA 1.25E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 3.76E-06 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 4.36E-07 4.36E-07 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 7.46E-06 7.46E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217157408 4.15E-06 4.15E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251