\
| Variant ID: vg0217154297 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17154297 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGATACGTTAAGGGAGAATAGCCACTATGGTCCCTGAAGTTTCGCTCTGAGATCGTTTTAGCCCCTGACCTTTCAAATTGTCTAAGCAAGCCCTTAAACT[T/C]
TATCATGTGGGCATATATAGTCCTTGGCCCATCGAAAATTGCCACGTGGGCATGTCATGTCATCTTCCAATGCAAATATATGATGAAATACCCAATTTAC
GTAAATTGGGTATTTCATCATATATTTGCATTGGAAGATGACATGACATGCCCACGTGGCAATTTTCGATGGGCCAAGGACTATATATGCCCACATGATA[A/G]
AGTTTAAGGGCTTGCTTAGACAATTTGAAAGGTCAGGGGCTAAAACGATCTCAGAGCGAAACTTCAGGGACCATAGTGGCTATTCTCCCTTAACGTATCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.00% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.70% | 14.50% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 58.30% | 39.10% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217154297 | T -> C | LOC_Os02g28970.1 | downstream_gene_variant ; 1765.0bp to feature; MODIFIER | silent_mutation | Average:52.98; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0217154297 | T -> C | LOC_Os02g28980.1 | downstream_gene_variant ; 2133.0bp to feature; MODIFIER | silent_mutation | Average:52.98; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0217154297 | T -> C | LOC_Os02g28970.2 | downstream_gene_variant ; 482.0bp to feature; MODIFIER | silent_mutation | Average:52.98; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0217154297 | T -> C | LOC_Os02g28970-LOC_Os02g28980 | intergenic_region ; MODIFIER | silent_mutation | Average:52.98; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217154297 | NA | 5.76E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | NA | 2.48E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | NA | 9.40E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | NA | 1.85E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | NA | 2.87E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | 2.84E-06 | 2.84E-06 | mr1815 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | NA | 4.46E-06 | mr1990 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217154297 | NA | 2.62E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |