\
| Variant ID: vg0217125730 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17125730 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 122. )
AGCACCGAGCACGGCGAAGAGTCCATCGCCACCTCGATGACGGTCGCCGAAACGCCAAGCACGGCGCCGACATCGTCGCCACCTCCAACGCGGATCCGCT[T/C]
GCCAGCAGGGCATTGGTGTTGATGCGAAAAAAACACACTGACCTGGAAGATCTGCTTAACTTCAGTGCAGGTCCAAAATCTTGCTTTTAGGTTTGTGAGC
GCTCACAAACCTAAAAGCAAGATTTTGGACCTGCACTGAAGTTAAGCAGATCTTCCAGGTCAGTGTGTTTTTTTCGCATCAACACCAATGCCCTGCTGGC[A/G]
AGCGGATCCGCGTTGGAGGTGGCGACGATGTCGGCGCCGTGCTTGGCGTTTCGGCGACCGTCATCGAGGTGGCGATGGACTCTTCGCCGTGCTCGGTGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 30.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 13.60% | 85.90% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.40% | 5.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 15.30% | 84.20% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 10.70% | 89.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.50% | 84.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217125730 | T -> C | LOC_Os02g28910.1 | missense_variant ; p.Leu155Ser; MODERATE | nonsynonymous_codon ; L155S | Average:73.903; most accessible tissue: Minghui63 young leaf, score: 84.144 | unknown | unknown | TOLERATED | 0.95 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217125730 | NA | 1.15E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | NA | 6.23E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 1.09E-07 | NA | mr1897 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 4.30E-09 | 1.20E-11 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 7.32E-06 | 7.32E-06 | mr1914 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 8.71E-06 | NA | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 1.40E-06 | 1.40E-06 | mr1927 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | NA | 6.01E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 1.29E-10 | NA | mr1317_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 5.40E-06 | 5.40E-06 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | NA | 1.76E-07 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | NA | 5.30E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | NA | 8.21E-07 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | NA | 3.57E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 8.25E-11 | 6.37E-13 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 1.66E-07 | 1.66E-07 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 4.34E-10 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217125730 | 2.37E-06 | 2.37E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |