Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0216805204:

Variant ID: vg0216805204 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16805204
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGAGTTACTACAAGATATATACTTCCTCCATTCTCGAATAAAATTAACGTGGACACTAATCTAGTTTAGACTTTGATTGCCTGGCTTTTTTTTCTAAA[G/T]
AAAACTATAAACACTTAGAAATATGTTATAGATATGCTATATTATTGATGTCTGTAAAAGCTTCATGAATATGAGCATCCATTTTTCATCACTCATAATA

Reverse complement sequence

TATTATGAGTGATGAAAAATGGATGCTCATATTCATGAAGCTTTTACAGACATCAATAATATAGCATATCTATAACATATTTCTAAGTGTTTATAGTTTT[C/A]
TTTAGAAAAAAAAGCCAGGCAATCAAAGTCTAAACTAGATTAGTGTCCACGTTAATTTTATTCGAGAATGGAGGAAGTATATATCTTGTAGTAACTCCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 2.40% 0.25% 1.48% NA
All Indica  2759 97.40% 0.00% 0.04% 2.54% NA
All Japonica  1512 91.90% 7.30% 0.73% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.00% 0.00% 1.08% NA
Indica III  913 93.90% 0.00% 0.11% 6.02% NA
Indica Intermediate  786 98.60% 0.10% 0.00% 1.27% NA
Temperate Japonica  767 87.90% 11.00% 1.17% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 11.20% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216805204 G -> T LOC_Os02g28410.1 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:36.485; most accessible tissue: Callus, score: 84.865 N N N N
vg0216805204 G -> T LOC_Os02g28420.1 downstream_gene_variant ; 2633.0bp to feature; MODIFIER silent_mutation Average:36.485; most accessible tissue: Callus, score: 84.865 N N N N
vg0216805204 G -> T LOC_Os02g28400-LOC_Os02g28410 intergenic_region ; MODIFIER silent_mutation Average:36.485; most accessible tissue: Callus, score: 84.865 N N N N
vg0216805204 G -> DEL N N silent_mutation Average:36.485; most accessible tissue: Callus, score: 84.865 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216805204 NA 3.27E-07 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0216805204 7.12E-08 2.02E-08 mr1897 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216805204 1.38E-07 1.38E-07 mr1317_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216805204 3.36E-06 3.36E-06 mr1608_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216805204 2.03E-07 2.03E-07 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216805204 2.69E-09 2.69E-09 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251