\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216773376:

Variant ID: vg0216773376 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16773376
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCCCCCTTTTCACTTTCGCAGTCCTCCTTGACGTCCTGCAACATCTGACCAAGATCATCCGCAACGTCGTTACCATCAGCATCCCTTTCCTCCTCGCC[C/T]
GTTTGATTTATTTCAAATCCAGCGTACTGAGCAAAGTCCGAAATATTGTCGTCTTCCACTTCATCTTCTTCCATTTCAACACCTTGCTCTCCGTGGGATG

Reverse complement sequence

CATCCCACGGAGAGCAAGGTGTTGAAATGGAAGAAGATGAAGTGGAAGACGACAATATTTCGGACTTTGCTCAGTACGCTGGATTTGAAATAAATCAAAC[G/A]
GGCGAGGAGGAAAGGGATGCTGATGGTAACGACGTTGCGGATGATCTTGGTCAGATGTTGCAGGACGTCAAGGAGGACTGCGAAAGTGAAAAGGGGGCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.10% 27.50% 38.13% 4.32% NA
All Indica  2759 42.10% 5.20% 47.37% 5.33% NA
All Japonica  1512 1.50% 74.10% 21.83% 2.58% NA
Aus  269 45.00% 1.90% 48.33% 4.83% NA
Indica I  595 46.70% 1.50% 40.50% 11.26% NA
Indica II  465 55.90% 10.10% 31.18% 2.80% NA
Indica III  913 32.50% 5.60% 59.80% 2.08% NA
Indica Intermediate  786 41.50% 4.70% 47.71% 6.11% NA
Temperate Japonica  767 0.80% 95.70% 3.13% 0.39% NA
Tropical Japonica  504 1.40% 38.90% 53.77% 5.95% NA
Japonica Intermediate  241 4.10% 78.80% 14.52% 2.49% NA
VI/Aromatic  96 93.80% 3.10% 3.12% 0.00% NA
Intermediate  90 30.00% 28.90% 35.56% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216773376 C -> T LOC_Os02g28380.1 synonymous_variant ; p.Thr25Thr; LOW synonymous_codon Average:25.974; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg0216773376 C -> DEL LOC_Os02g28380.1 N frameshift_variant Average:25.974; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216773376 NA 7.40E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 NA 4.50E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 8.36E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 3.45E-06 1.36E-08 mr1129 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 1.09E-06 NA mr1235 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 7.24E-07 3.76E-08 mr1235 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 NA 9.78E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 NA 1.15E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 NA 1.47E-07 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 NA 1.60E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 8.98E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 9.50E-06 3.45E-08 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 1.38E-06 NA mr1423 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 7.55E-07 8.93E-09 mr1423 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 2.59E-06 NA mr1435 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 3.71E-06 1.12E-08 mr1435 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 4.03E-09 NA mr1599 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 1.68E-09 4.45E-11 mr1599 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216773376 NA 8.04E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251