\
| Variant ID: vg0216716595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 16716595 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGTACTCTCTATCGGGCCTTAATAAAAGGCCGTCAAAAAAGAGTGTCATCGGGTCATCTGTGACGGGCTTCTTTTAGGGCCCGATTAAGATATGGAACC[C/T]
TCATCTCAATCGGGCCTCAACTATAGCCCGTCACAGATAAGTGTCATCCGTGACGGGCTTTAGTTTTATGCCGATATACCATAGCTGTGCGACCATATCT
AGATATGGTCGCACAGCTATGGTATATCGGCATAAAACTAAAGCCCGTCACGGATGACACTTATCTGTGACGGGCTATAGTTGAGGCCCGATTGAGATGA[G/A]
GGTTCCATATCTTAATCGGGCCCTAAAAGAAGCCCGTCACAGATGACCCGATGACACTCTTTTTTGACGGCCTTTTATTAAGGCCCGATAGAGAGTACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 29.10% | 6.83% | 27.63% | NA |
| All Indica | 2759 | 42.60% | 8.20% | 9.42% | 39.80% | NA |
| All Japonica | 1512 | 22.00% | 73.90% | 1.12% | 2.91% | NA |
| Aus | 269 | 35.70% | 1.10% | 13.38% | 49.81% | NA |
| Indica I | 595 | 36.50% | 2.20% | 15.63% | 45.71% | NA |
| Indica II | 465 | 37.00% | 11.40% | 7.10% | 44.52% | NA |
| Indica III | 913 | 49.50% | 12.60% | 5.70% | 32.20% | NA |
| Indica Intermediate | 786 | 42.60% | 5.60% | 10.43% | 41.35% | NA |
| Temperate Japonica | 767 | 3.50% | 95.70% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 53.20% | 38.50% | 2.18% | 6.15% | NA |
| Japonica Intermediate | 241 | 15.80% | 78.80% | 2.07% | 3.32% | NA |
| VI/Aromatic | 96 | 83.30% | 3.10% | 4.17% | 9.38% | NA |
| Intermediate | 90 | 40.00% | 30.00% | 6.67% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0216716595 | C -> T | LOC_Os02g28250.1 | upstream_gene_variant ; 3541.0bp to feature; MODIFIER | silent_mutation | Average:53.254; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0216716595 | C -> T | LOC_Os02g28260.1 | upstream_gene_variant ; 915.0bp to feature; MODIFIER | silent_mutation | Average:53.254; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0216716595 | C -> T | LOC_Os02g28270.1 | downstream_gene_variant ; 2156.0bp to feature; MODIFIER | silent_mutation | Average:53.254; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0216716595 | C -> T | LOC_Os02g28280.1 | downstream_gene_variant ; 4620.0bp to feature; MODIFIER | silent_mutation | Average:53.254; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0216716595 | C -> T | LOC_Os02g28260-LOC_Os02g28270 | intergenic_region ; MODIFIER | silent_mutation | Average:53.254; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0216716595 | C -> DEL | N | N | silent_mutation | Average:53.254; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0216716595 | 4.37E-07 | NA | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 3.02E-06 | 2.66E-10 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 6.89E-06 | NA | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 7.52E-11 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 1.00E-08 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 3.37E-08 | 1.40E-16 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 5.06E-06 | 3.25E-37 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 5.71E-14 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.03E-08 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 9.99E-07 | 2.90E-33 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 8.80E-13 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.38E-19 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.68E-08 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 2.88E-09 | 9.49E-32 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 4.48E-07 | 6.90E-14 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 6.85E-08 | 1.30E-38 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 3.60E-07 | 2.03E-15 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 8.75E-06 | 1.09E-26 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 3.94E-10 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 2.34E-07 | 1.59E-39 | mr1435 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 4.96E-14 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 1.63E-06 | NA | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 3.43E-06 | 9.68E-12 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 2.82E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 6.34E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 4.87E-13 | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 5.45E-38 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.04E-13 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.67E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 4.52E-06 | 9.68E-07 | mr1207_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 8.32E-06 | 1.72E-06 | mr1209_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 8.13E-06 | 8.13E-06 | mr1209_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 2.13E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 3.30E-06 | mr1229_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 8.74E-06 | mr1230_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 4.99E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 9.00E-07 | 2.36E-11 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 8.30E-09 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.08E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 4.25E-24 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 3.61E-10 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 2.23E-39 | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.04E-13 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 9.51E-06 | mr1306_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.98E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.37E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 9.75E-09 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.69E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 3.90E-06 | mr1597_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 3.75E-08 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 2.60E-08 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 2.03E-06 | NA | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | 1.40E-07 | 1.32E-08 | mr1880_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0216716595 | NA | 1.96E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |