Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0216351003:

Variant ID: vg0216351003 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16351003
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, T: 0.38, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

TACATATCTCCCATATGATTTCATAATTCATAAGAGATGTGTAAATTTTATGAACAATGTTACCATCATTTTGTCGGATGAAGAAATGACCAAAATAAAA[T/G]
TTATAGATATTTATGAATTATATAACTTTGTTATTGATGACATTTTCATTTGAAATCATTTAATATTTGAAAATATTGTTTGAAGTTGTTATAATTTGAA

Reverse complement sequence

TTCAAATTATAACAACTTCAAACAATATTTTCAAATATTAAATGATTTCAAATGAAAATGTCATCAATAACAAAGTTATATAATTCATAAATATCTATAA[A/C]
TTTTATTTTGGTCATTTCTTCATCCGACAAAATGATGGTAACATTGTTCATAAAATTTACACATCTCTTATGAATTATGAAATCATATGGGAGATATGTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.70%	23.80%	0.53%	40.90%	NA
All Indica	2759	3.80%	33.30%	0.72%	62.20%	NA
All Japonica	1512	98.30%	0.90%	0.00%	0.86%	NA
Aus	269	1.10%	32.70%	0.74%	65.43%	NA
Indica I	595	0.30%	22.20%	1.18%	76.30%	NA
Indica II	465	10.80%	32.70%	0.65%	55.91%	NA
Indica III	913	2.80%	44.80%	0.33%	52.03%	NA
Indica Intermediate	786	3.30%	28.80%	0.89%	67.05%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	98.20%	1.20%	0.00%	0.60%	NA
Japonica Intermediate	241	95.90%	2.90%	0.00%	1.24%	NA
VI/Aromatic	96	11.50%	84.40%	1.04%	3.12%	NA
Intermediate	90	42.20%	27.80%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216351003	T -> G	LOC_Os02g27594.1	upstream_gene_variant ; 737.0bp to feature; MODIFIER	silent_mutation	Average:28.49; most accessible tissue: Callus, score: 62.811	N	N	N	N
vg0216351003	T -> G	LOC_Os02g27594.2	upstream_gene_variant ; 737.0bp to feature; MODIFIER	silent_mutation	Average:28.49; most accessible tissue: Callus, score: 62.811	N	N	N	N
vg0216351003	T -> G	LOC_Os02g27594.3	upstream_gene_variant ; 737.0bp to feature; MODIFIER	silent_mutation	Average:28.49; most accessible tissue: Callus, score: 62.811	N	N	N	N
vg0216351003	T -> G	LOC_Os02g27594-LOC_Os02g27600	intergenic_region ; MODIFIER	silent_mutation	Average:28.49; most accessible tissue: Callus, score: 62.811	N	N	N	N
vg0216351003	T -> DEL	N	N	silent_mutation	Average:28.49; most accessible tissue: Callus, score: 62.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216351003	NA	8.06E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.91E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	3.20E-06	mr1283	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	7.38E-07	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	6.89E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.80E-06	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	8.40E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	6.30E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	3.02E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.94E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.68E-07	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.53E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	8.87E-06	mr1412	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	3.99E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.50E-06	mr1513	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	5.47E-08	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	2.39E-06	2.38E-06	mr1694	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.61E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	3.75E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	7.49E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.00E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	5.57E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	7.02E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	4.67E-21	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.84E-13	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	3.50E-06	mr1941	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	8.18E-09	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	7.13E-08	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	7.77E-09	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.19E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.13E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.02E-22	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.75E-14	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	3.10E-06	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	1.92E-10	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003	NA	2.43E-09	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251