\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0216351003:

Variant ID: vg0216351003 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 16351003
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, T: 0.38, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TACATATCTCCCATATGATTTCATAATTCATAAGAGATGTGTAAATTTTATGAACAATGTTACCATCATTTTGTCGGATGAAGAAATGACCAAAATAAAA[T/G]
TTATAGATATTTATGAATTATATAACTTTGTTATTGATGACATTTTCATTTGAAATCATTTAATATTTGAAAATATTGTTTGAAGTTGTTATAATTTGAA

Reverse complement sequence

TTCAAATTATAACAACTTCAAACAATATTTTCAAATATTAAATGATTTCAAATGAAAATGTCATCAATAACAAAGTTATATAATTCATAAATATCTATAA[A/C]
TTTTATTTTGGTCATTTCTTCATCCGACAAAATGATGGTAACATTGTTCATAAAATTTACACATCTCTTATGAATTATGAAATCATATGGGAGATATGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.70% 23.80% 0.53% 40.90% NA
All Indica  2759 3.80% 33.30% 0.72% 62.20% NA
All Japonica  1512 98.30% 0.90% 0.00% 0.86% NA
Aus  269 1.10% 32.70% 0.74% 65.43% NA
Indica I  595 0.30% 22.20% 1.18% 76.30% NA
Indica II  465 10.80% 32.70% 0.65% 55.91% NA
Indica III  913 2.80% 44.80% 0.33% 52.03% NA
Indica Intermediate  786 3.30% 28.80% 0.89% 67.05% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 98.20% 1.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.90% 2.90% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 84.40% 1.04% 3.12% NA
Intermediate  90 42.20% 27.80% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0216351003 T -> G LOC_Os02g27594.1 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:28.49; most accessible tissue: Callus, score: 62.811 N N N N
vg0216351003 T -> G LOC_Os02g27594.2 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:28.49; most accessible tissue: Callus, score: 62.811 N N N N
vg0216351003 T -> G LOC_Os02g27594.3 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:28.49; most accessible tissue: Callus, score: 62.811 N N N N
vg0216351003 T -> G LOC_Os02g27594-LOC_Os02g27600 intergenic_region ; MODIFIER silent_mutation Average:28.49; most accessible tissue: Callus, score: 62.811 N N N N
vg0216351003 T -> DEL N N silent_mutation Average:28.49; most accessible tissue: Callus, score: 62.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0216351003 NA 8.06E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.91E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 3.20E-06 mr1283 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 7.38E-07 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 6.89E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.80E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 8.40E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 6.30E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 3.02E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.94E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.68E-07 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.53E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 8.87E-06 mr1412 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 3.99E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.50E-06 mr1513 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 5.47E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 2.39E-06 2.38E-06 mr1694 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.61E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 3.75E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 7.49E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.00E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 5.57E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 7.02E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 4.67E-21 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.84E-13 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 3.50E-06 mr1941 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 8.18E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 7.13E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 7.77E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.19E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.13E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.02E-22 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.75E-14 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 3.10E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 1.92E-10 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216351003 NA 2.43E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251