Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0216320398:

Variant ID: vg0216320398 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 16320398
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCATCCGGTGCAGCTCCGTCAACACCAGCGCGGTCATGGCTATCGTGGCCTCTAACTTCCACTCCAGGCCGAGTACCATTTCGATTTTGGTGGTGCGTG[C/T]
GTAATTTCTCTGTCTTCTGAACTGTGCTTGTGCTCATTCCAGAGAGATCAGGATGGCTTATATAGCTGTTCGATCCGTTGATCCGTTGGATATATCTCTC

Reverse complement sequence

GAGAGATATATCCAACGGATCAACGGATCGAACAGCTATATAAGCCATCCTGATCTCTCTGGAATGAGCACAAGCACAGTTCAGAAGACAGAGAAATTAC[G/A]
CACGCACCACCAAAATCGAAATGGTACTCGGCCTGGAGTGGAAGTTAGAGGCCACGATAGCCATGACCGCGCTGGTGTTGACGGAGCTGCACCGGATGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.20%	9.70%	1.14%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	67.00%	29.50%	3.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	39.40%	55.50%	5.08%	0.00%	NA
Tropical Japonica	504	97.60%	0.80%	1.59%	0.00%	NA
Japonica Intermediate	241	90.90%	6.60%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0216320398	C -> T	LOC_Os02g27550.1	upstream_gene_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:66.636; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0216320398	C -> T	LOC_Os02g27560.1	downstream_gene_variant ; 954.0bp to feature; MODIFIER	silent_mutation	Average:66.636; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0216320398	C -> T	LOC_Os02g27570.1	downstream_gene_variant ; 3918.0bp to feature; MODIFIER	silent_mutation	Average:66.636; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0216320398	C -> T	LOC_Os02g27550-LOC_Os02g27560	intergenic_region ; MODIFIER	silent_mutation	Average:66.636; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0216320398	NA	8.09E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0216320398	NA	4.82E-06	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	3.70E-11	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.38E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.45E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	4.83E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	2.44E-26	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	2.74E-11	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.11E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	2.57E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.56E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.20E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.85E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.76E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	3.60E-06	4.90E-10	mr1748_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	1.11E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	2.43E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0216320398	NA	4.95E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251