\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0215909137:

Variant ID: vg0215909137 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 15909137
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.48, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTGACTTCTTGTTTCTATAAAAACATTTATTGAAAACTGATATATGTATACTTTTATGAAAGCATTTTTCAAGACAAATCTATTTATATAATTTTTA[T/C]
ATTTTCAAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCCAAGGCTTAACTTAAACATTGTCCTAAACGACTTTCTTTACAAGTAAGGAGGGAG

Reverse complement sequence

CTCCCTCCTTACTTGTAAAGAAAGTCGTTTAGGACAATGTTTAAGTTAAGCCTTGGGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTTGAAAAT[A/G]
TAAAAATTATATAAATAGATTTGTCTTGAAAAATGCTTTCATAAAAGTATACATATATCAGTTTTCAATAAATGTTTTTATAGAAACAAGAAGTCAAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.40% 0.17% 0.00% NA
All Indica  2759 96.30% 3.60% 0.14% 0.00% NA
All Japonica  1512 1.70% 98.10% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 89.00% 10.80% 0.22% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 2.80% 0.25% 0.00% NA
Temperate Japonica  767 1.20% 98.60% 0.26% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0215909137 T -> C LOC_Os02g27060.1 upstream_gene_variant ; 1573.0bp to feature; MODIFIER silent_mutation Average:43.421; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0215909137 T -> C LOC_Os02g27060.2 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:43.421; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0215909137 T -> C LOC_Os02g27050.1 downstream_gene_variant ; 4921.0bp to feature; MODIFIER silent_mutation Average:43.421; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0215909137 T -> C LOC_Os02g27050-LOC_Os02g27060 intergenic_region ; MODIFIER silent_mutation Average:43.421; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0215909137 NA 5.42E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 4.13E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 7.09E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.38E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.10E-12 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.89E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 7.54E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 2.13E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.37E-15 mr1301 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.86E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.77E-15 mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.10E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 6.08E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 9.58E-29 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.36E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 6.35E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.49E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 3.92E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 4.29E-36 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 4.36E-09 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 7.33E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 6.62E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.93E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.58E-41 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.83E-07 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 3.03E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 5.26E-16 mr1301_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 4.62E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 3.34E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 3.03E-06 3.48E-18 mr1410_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 3.93E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 6.06E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 4.09E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 8.82E-11 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 1.81E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 3.26E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215909137 NA 7.12E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251