Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0215735517:

Variant ID: vg0215735517 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 15735517
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCTTCACGGCGCGCGTCGTGCAGCAGTACAAGGCCATGTGGGAGGCCGAGATGGACGCCGTCGTGGACGACGTGCGCGGCGACGCGGTGGCGCAGGGC[A/G]
CCGGCTTCGTGGTGCGACGCAGGCTGCAGCTCATGCTGTACAACATCATGTACCGGATGATGTTCGACGCGCGGTTCGAGTCGGTGGACGACCCCATGTT

Reverse complement sequence

AACATGGGGTCGTCCACCGACTCGAACCGCGCGTCGAACATCATCCGGTACATGATGTTGTACAGCATGAGCTGCAGCCTGCGTCGCACCACGAAGCCGG[T/C]
GCCCTGCGCCACCGCGTCGCCGCGCACGTCGTCCACGACGGCGTCCATCTCGGCCTCCCACATGGCCTTGTACTGCTGCACGACGCGCGCCGTGAAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	35.90%	0.08%	0.28%	NA
All Indica	2759	96.50%	3.20%	0.07%	0.25%	NA
All Japonica	1512	1.60%	98.10%	0.13%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	89.70%	9.70%	0.00%	0.65%	NA
Indica III	913	97.40%	2.40%	0.11%	0.11%	NA
Indica Intermediate	786	97.10%	2.50%	0.00%	0.38%	NA
Temperate Japonica	767	1.00%	98.70%	0.13%	0.13%	NA
Tropical Japonica	504	2.20%	97.60%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.50%	0.00%	0.41%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	45.60%	50.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0215735517	A -> G	LOC_Os02g26810.1	missense_variant ; p.Thr196Ala; MODERATE	nonsynonymous_codon ; T196A	Average:26.629; most accessible tissue: Zhenshan97 flower, score: 55.587	benign	-1.484	TOLERATED	0.45
vg0215735517	A -> DEL	LOC_Os02g26810.1	N	frameshift_variant	Average:26.629; most accessible tissue: Zhenshan97 flower, score: 55.587	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0215735517	NA	3.90E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	1.18E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	1.49E-16	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	1.75E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	9.57E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	4.48E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	1.98E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	9.12E-09	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	6.11E-06	6.11E-06	mr1337_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	4.90E-18	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	1.01E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	7.13E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	2.48E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	9.12E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	7.76E-07	mr1754_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	1.06E-31	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	2.75E-06	2.75E-06	mr1891_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	4.75E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215735517	NA	8.89E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251