\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0215681856:

Variant ID: vg0215681856 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 15681856
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.37, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTCAAGCTGAGTCTGGCCTACGGCTCTATGATGTACCCGAATATGGAGGGATACAAAGGGCAGACATGACTGTCACGACCTGCCGCCTACCTCACTTT[T/C]
CGTGGAGCACACGGTAACCGCTAACCTATAAATCACGCCTAAGTTATTGATTACTACTCTAGTCTCGCGCATGAACTTTTTTTTTTATCCAGAGTCCTAG

Reverse complement sequence

CTAGGACTCTGGATAAAAAAAAAAGTTCATGCGCGAGACTAGAGTAGTAATCAATAACTTAGGCGTGATTTATAGGTTAGCGGTTACCGTGTGCTCCACG[A/G]
AAAGTGAGGTAGGCGGCAGGTCGTGACAGTCATGTCTGCCCTTTGTATCCCTCCATATTCGGGTACATCATAGAGCCGTAGGCCAGACTCAGCTTGAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.20% 0.06% 0.30% NA
All Indica  2759 96.30% 3.30% 0.00% 0.33% NA
All Japonica  1512 1.50% 98.30% 0.07% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 89.20% 10.10% 0.00% 0.65% NA
Indica III  913 97.40% 2.40% 0.00% 0.22% NA
Indica Intermediate  786 96.60% 2.90% 0.00% 0.51% NA
Temperate Japonica  767 1.00% 98.80% 0.00% 0.13% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.50% 0.41% 0.41% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 43.30% 51.10% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0215681856 T -> DEL N N silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.1 upstream_gene_variant ; 2167.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.2 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.3 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.4 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.6 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.7 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.9 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700.8 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0215681856 T -> C LOC_Os02g26700-LOC_Os02g26710 intergenic_region ; MODIFIER silent_mutation Average:63.835; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0215681856 NA 3.11E-71 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 3.42E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.29E-41 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.88E-47 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.84E-34 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.22E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 7.63E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 8.77E-28 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.44E-46 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 5.49E-56 mr1154 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.71E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.36E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.64E-89 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.73E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 9.99E-20 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.79E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.68E-28 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.52E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.25E-42 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 4.04E-32 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 5.75E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.32E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.62E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.95E-59 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.96E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.11E-19 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 3.05E-106 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 5.36E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.29E-38 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 8.58E-32 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 7.77E-40 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 3.92E-70 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 7.00E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 2.36E-42 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 7.34E-40 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 5.73E-51 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 3.14E-52 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.11E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.01E-76 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 6.66E-39 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 6.75E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 7.08E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 3.11E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.86E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.18E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 9.49E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 7.08E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.72E-61 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0215681856 NA 1.04E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251