Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214641768:

Variant ID: vg0214641768 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 14641768
Reference Allele: AG	Alternative Allele: GG,A
Primary Allele: AG	Secondary Allele: GG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAGATGCGACATCGTGGATTACTCCAAGCGGTGAAGCTTGAATCAAGAGCACCTTGCTCTGATACCAATTGAACGCGCTGATGAAGCCTAGAGGGGGG[AG/GG,A]
GGGTGAATAGGCTGTCCCTGAAAACTTAAAAACAAATCGCAGCGGTAAAATTTAAACAGACCCGGAACTTCCTGGTAAGGAACTCCGGAACTTTTGGCCT

Reverse complement sequence

AGGCCAAAAGTTCCGGAGTTCCTTACCAGGAAGTTCCGGGTCTGTTTAAATTTTACCGCTGCGATTTGTTTTTAAGTTTTCAGGGACAGCCTATTCACCC[CT/CC,T]
CCCCCCTCTAGGCTTCATCAGCGCGTTCAATTGGTATCAGAGCAAGGTGCTCTTGATTCAAGCTTCACCGCTTGGAGTAATCCACGATGTCGCATCTAGA

Allele Frequencies:

Populations	Population Size	Frequency of AG(primary allele)	Frequency of GG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	3.00%	19.78%	7.53%	A: 0.02%
All Indica	2759	56.40%	4.60%	28.31%	10.66%	NA
All Japonica	1512	98.90%	0.00%	0.60%	0.40%	A: 0.07%
Aus	269	26.40%	5.20%	48.70%	19.70%	NA
Indica I	595	38.30%	0.00%	51.43%	10.25%	NA
Indica II	465	63.70%	2.80%	20.65%	12.90%	NA
Indica III	913	68.30%	8.70%	14.13%	8.87%	NA
Indica Intermediate	786	51.90%	4.60%	31.81%	11.70%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	97.80%	0.00%	1.39%	0.60%	A: 0.20%
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	82.20%	1.10%	13.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0214641768	AG -> A	LOC_Os02g25170.1	upstream_gene_variant ; 119.0bp to feature; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0214641768	AG -> A	LOC_Os02g25180.1	upstream_gene_variant ; 2929.0bp to feature; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0214641768	AG -> A	LOC_Os02g25170-LOC_Os02g25180	intergenic_region ; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0214641768	AG -> GG	LOC_Os02g25170.1	upstream_gene_variant ; 118.0bp to feature; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0214641768	AG -> GG	LOC_Os02g25180.1	upstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0214641768	AG -> GG	LOC_Os02g25170-LOC_Os02g25180	intergenic_region ; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0214641768	AG -> DEL	N	N	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0214641768	8.31E-06	NA	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	1.06E-06	NA	mr1598	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	3.47E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	6.29E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	5.03E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	6.01E-10	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	1.29E-17	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	9.06E-15	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	6.52E-16	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	6.11E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	3.83E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	8.18E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	1.19E-18	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	1.03E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	1.20E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	3.45E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768	NA	4.50E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251