\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214641768:

Variant ID: vg0214641768 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 14641768
Reference Allele: AGAlternative Allele: GG,A
Primary Allele: AGSecondary Allele: GG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGATGCGACATCGTGGATTACTCCAAGCGGTGAAGCTTGAATCAAGAGCACCTTGCTCTGATACCAATTGAACGCGCTGATGAAGCCTAGAGGGGGG[AG/GG,A]
GGGTGAATAGGCTGTCCCTGAAAACTTAAAAACAAATCGCAGCGGTAAAATTTAAACAGACCCGGAACTTCCTGGTAAGGAACTCCGGAACTTTTGGCCT

Reverse complement sequence

AGGCCAAAAGTTCCGGAGTTCCTTACCAGGAAGTTCCGGGTCTGTTTAAATTTTACCGCTGCGATTTGTTTTTAAGTTTTCAGGGACAGCCTATTCACCC[CT/CC,T]
CCCCCCTCTAGGCTTCATCAGCGCGTTCAATTGGTATCAGAGCAAGGTGCTCTTGATTCAAGCTTCACCGCTTGGAGTAATCCACGATGTCGCATCTAGA

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of GG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 3.00% 19.78% 7.53% A: 0.02%
All Indica  2759 56.40% 4.60% 28.31% 10.66% NA
All Japonica  1512 98.90% 0.00% 0.60% 0.40% A: 0.07%
Aus  269 26.40% 5.20% 48.70% 19.70% NA
Indica I  595 38.30% 0.00% 51.43% 10.25% NA
Indica II  465 63.70% 2.80% 20.65% 12.90% NA
Indica III  913 68.30% 8.70% 14.13% 8.87% NA
Indica Intermediate  786 51.90% 4.60% 31.81% 11.70% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 97.80% 0.00% 1.39% 0.60% A: 0.20%
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 82.20% 1.10% 13.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214641768 AG -> A LOC_Os02g25170.1 upstream_gene_variant ; 119.0bp to feature; MODIFIER silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0214641768 AG -> A LOC_Os02g25180.1 upstream_gene_variant ; 2929.0bp to feature; MODIFIER silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0214641768 AG -> A LOC_Os02g25170-LOC_Os02g25180 intergenic_region ; MODIFIER silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0214641768 AG -> GG LOC_Os02g25170.1 upstream_gene_variant ; 118.0bp to feature; MODIFIER silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0214641768 AG -> GG LOC_Os02g25180.1 upstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0214641768 AG -> GG LOC_Os02g25170-LOC_Os02g25180 intergenic_region ; MODIFIER silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg0214641768 AG -> DEL N N silent_mutation Average:42.817; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214641768 8.31E-06 NA mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 1.06E-06 NA mr1598 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 3.47E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 6.29E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 5.03E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 6.01E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 1.29E-17 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 9.06E-15 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 6.52E-16 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 6.11E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 3.83E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 8.18E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 1.19E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 1.03E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 1.20E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 3.45E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214641768 NA 4.50E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251