\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0214233942:

Variant ID: vg0214233942 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 14233942
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GATCTTCGCCATAAGGAGGATGAGCGTCGGGTCGTGGCGGACGCCATAAAGAAATCTAGCGTCGAGAACAAGTCCCTCACGGGGGAAAACAAGTCTCTCC[G/A]
CGTCGACCTGGACGGAGCGAACAAGAGGGCCGCCGAACGGGAGCGCCAGCTCGCTGCGGCTTTGGAAAAGATTAAATCCCTTGAAACACAGCTTGTCTCA

Reverse complement sequence

TGAGACAAGCTGTGTTTCAAGGGATTTAATCTTTTCCAAAGCCGCAGCGAGCTGGCGCTCCCGTTCGGCGGCCCTCTTGTTCGCTCCGTCCAGGTCGACG[C/T]
GGAGAGACTTGTTTTCCCCCGTGAGGGACTTGTTCTCGACGCTAGATTTCTTTATGGCGTCCGCCACGACCCGACGCTCATCCTCCTTATGGCGAAGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.50% 5.60% 8.97% 53.94% NA
All Indica  2759 4.70% 0.50% 11.31% 83.47% NA
All Japonica  1512 79.80% 16.10% 2.71% 1.39% NA
Aus  269 6.70% 0.00% 22.68% 70.63% NA
Indica I  595 4.70% 0.20% 21.34% 73.78% NA
Indica II  465 6.90% 1.50% 11.18% 80.43% NA
Indica III  913 3.00% 0.10% 5.15% 91.79% NA
Indica Intermediate  786 5.60% 0.50% 10.94% 82.95% NA
Temperate Japonica  767 97.80% 0.30% 1.17% 0.78% NA
Tropical Japonica  504 48.80% 44.00% 4.96% 2.18% NA
Japonica Intermediate  241 87.60% 7.90% 2.90% 1.66% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 43.30% 11.10% 10.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0214233942 G -> A LOC_Os02g24560.1 missense_variant ; p.Arg130His; MODERATE nonsynonymous_codon ; R130H Average:13.765; most accessible tissue: Callus, score: 47.209 benign 0.433 TOLERATED 0.11
vg0214233942 G -> DEL LOC_Os02g24560.1 N frameshift_variant Average:13.765; most accessible tissue: Callus, score: 47.209 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0214233942 NA 2.76E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 4.18E-09 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 1.56E-06 1.56E-06 mr1266 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 5.28E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 1.11E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 1.83E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 7.96E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 2.61E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 2.90E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 2.26E-06 mr1648 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 6.86E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 3.98E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 1.11E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 6.66E-09 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 9.81E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0214233942 NA 2.55E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251