\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212899554:

Variant ID: vg0212899554 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12899554
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTATGCTAACATGATGGATATAATAAATCTATTTAAAATAACATTATGATTATAGTGATGTATTGGCTAAGACAAAAGATCAAACTAAACCGAGACAG[T/C]
CACAAGTAAATCGATGTGTCACAAAACACGATGCAATTAAAGGTAGAATTGAAATATCGGGTAGGCAAATATACCAATCGAACCAGTTCAATCCAAGAGA

Reverse complement sequence

TCTCTTGGATTGAACTGGTTCGATTGGTATATTTGCCTACCCGATATTTCAATTCTACCTTTAATTGCATCGTGTTTTGTGACACATCGATTTACTTGTG[A/G]
CTGTCTCGGTTTAGTTTGATCTTTTGTCTTAGCCAATACATCACTATAATCATAATGTTATTTTAAATAGATTTATTATATCCATCATGTTAGCATAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.00% 0.89% 0.00% NA
All Indica  2759 95.30% 3.30% 1.41% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 84.00% 10.90% 5.04% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 95.90% 3.10% 1.02% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212899554 T -> C LOC_Os02g21700.1 downstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:41.178; most accessible tissue: Zhenshan97 young leaf, score: 73.54 N N N N
vg0212899554 T -> C LOC_Os02g21700-LOC_Os02g21710 intergenic_region ; MODIFIER silent_mutation Average:41.178; most accessible tissue: Zhenshan97 young leaf, score: 73.54 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212899554 NA 6.02E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 NA 5.64E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 NA 1.57E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 7.33E-10 NA mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 2.60E-08 2.24E-17 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 NA 1.86E-07 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 NA 2.46E-10 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212899554 NA 1.27E-08 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251