Variant ID: vg0212899554 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 12899554 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 318. )
ATCTATGCTAACATGATGGATATAATAAATCTATTTAAAATAACATTATGATTATAGTGATGTATTGGCTAAGACAAAAGATCAAACTAAACCGAGACAG[T/C]
CACAAGTAAATCGATGTGTCACAAAACACGATGCAATTAAAGGTAGAATTGAAATATCGGGTAGGCAAATATACCAATCGAACCAGTTCAATCCAAGAGA
TCTCTTGGATTGAACTGGTTCGATTGGTATATTTGCCTACCCGATATTTCAATTCTACCTTTAATTGCATCGTGTTTTGTGACACATCGATTTACTTGTG[A/G]
CTGTCTCGGTTTAGTTTGATCTTTTGTCTTAGCCAATACATCACTATAATCATAATGTTATTTTAAATAGATTTATTATATCCATCATGTTAGCATAGAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.10% | 2.00% | 0.89% | 0.00% | NA |
All Indica | 2759 | 95.30% | 3.30% | 1.41% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 84.00% | 10.90% | 5.04% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 95.90% | 3.10% | 1.02% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0212899554 | T -> C | LOC_Os02g21700.1 | downstream_gene_variant ; 4121.0bp to feature; MODIFIER | silent_mutation | Average:41.178; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
vg0212899554 | T -> C | LOC_Os02g21700-LOC_Os02g21710 | intergenic_region ; MODIFIER | silent_mutation | Average:41.178; most accessible tissue: Zhenshan97 young leaf, score: 73.54 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0212899554 | NA | 6.02E-06 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | NA | 5.64E-09 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | NA | 1.57E-06 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | 7.33E-10 | NA | mr1855_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | 2.60E-08 | 2.24E-17 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | NA | 1.86E-07 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | NA | 2.46E-10 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0212899554 | NA | 1.27E-08 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |