\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212843658:

Variant ID: vg0212843658 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12843658
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTGGGAATTATATTCTTAGTAATGTCGTTAAGAAATACCGACAGCGGTATCATCCAAGTGCTAAAAGGATGTTGGATCAAAGCCGAAATTAGTGTCC[G/A]
AGTTCAAAGCTAAAGATTGCAAACACCTGTTTCGACAGATCTGGCTCAGCCGCCTTGTTCTCCCCTTTGCCGGACCTTGCAATGGTGGTCGTCCCCGTGC

Reverse complement sequence

GCACGGGGACGACCACCATTGCAAGGTCCGGCAAAGGGGAGAACAAGGCGGCTGAGCCAGATCTGTCGAAACAGGTGTTTGCAATCTTTAGCTTTGAACT[C/T]
GGACACTAATTTCGGCTTTGATCCAACATCCTTTTAGCACTTGGATGATACCGCTGTCGGTATTTCTTAACGACATTACTAAGAATATAATTCCCAGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.90% 11.50% 2.54% 63.06% NA
All Indica  2759 1.60% 0.40% 2.68% 95.36% NA
All Japonica  1512 62.30% 33.70% 2.18% 1.79% NA
Aus  269 0.40% 0.00% 2.23% 97.40% NA
Indica I  595 1.70% 0.20% 5.38% 92.77% NA
Indica II  465 1.10% 1.10% 4.09% 93.76% NA
Indica III  913 0.80% 0.10% 0.55% 98.58% NA
Indica Intermediate  786 2.70% 0.50% 2.29% 94.53% NA
Temperate Japonica  767 91.70% 5.70% 1.43% 1.17% NA
Tropical Japonica  504 15.90% 77.80% 3.97% 2.38% NA
Japonica Intermediate  241 66.00% 30.70% 0.83% 2.49% NA
VI/Aromatic  96 72.90% 2.10% 0.00% 25.00% NA
Intermediate  90 28.90% 23.30% 7.78% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212843658 G -> A LOC_Os02g21630.1 upstream_gene_variant ; 2813.0bp to feature; MODIFIER silent_mutation Average:8.31; most accessible tissue: Callus, score: 33.653 N N N N
vg0212843658 G -> A LOC_Os02g21620.1 intron_variant ; MODIFIER silent_mutation Average:8.31; most accessible tissue: Callus, score: 33.653 N N N N
vg0212843658 G -> DEL N N silent_mutation Average:8.31; most accessible tissue: Callus, score: 33.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212843658 NA 5.50E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 2.15E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 8.80E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 4.59E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 6.06E-07 NA mr1364 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.19E-08 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 7.83E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.16E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 2.09E-07 1.24E-07 mr1443 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 6.76E-09 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.36E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.20E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 2.31E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 5.83E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 6.08E-13 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 5.08E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 3.48E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 4.53E-33 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.73E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.99E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 8.40E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.77E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.75E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 4.50E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 7.26E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.27E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 3.38E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.72E-11 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 3.51E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 2.78E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 3.91E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 2.85E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 2.13E-35 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.50E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 3.27E-11 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 7.91E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 5.20E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.25E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 2.38E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212843658 NA 1.44E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251