\
| Variant ID: vg0212840665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12840665 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACCAAACAACAAAGAACATGCTTGCATAGGGACAAGATCAAAATTGGCAGTATCATGGTAATTCCCAATCGAAAAGTTTATTCTCACAATTCTATTTAC[C/T]
TTGAACTTACCACAAGAGTTGAACCATTTGATGTAATATGGATGAGGATGCGGTTGTGTAAGCAACTCAAGTTTCTCAACCAAATCTGAACTCACAAAGT
ACTTTGTGAGTTCAGATTTGGTTGAGAAACTTGAGTTGCTTACACAACCGCATCCTCATCCATATTACATCAAATGGTTCAACTCTTGTGGTAAGTTCAA[G/A]
GTAAATAGAATTGTGAGAATAAACTTTTCGATTGGGAATTACCATGATACTGCCAATTTTGATCTTGTCCCTATGCAAGCATGTTCTTTGTTGTTTGGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.30% | 7.80% | 7.15% | 2.77% | NA |
| All Indica | 2759 | 76.00% | 8.80% | 10.62% | 4.53% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 42.40% | 43.90% | 13.01% | 0.74% | NA |
| Indica I | 595 | 88.70% | 1.00% | 8.40% | 1.85% | NA |
| Indica II | 465 | 72.50% | 8.60% | 15.70% | 3.23% | NA |
| Indica III | 913 | 68.70% | 14.80% | 9.20% | 7.34% | NA |
| Indica Intermediate | 786 | 77.10% | 7.90% | 10.94% | 4.07% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 2.20% | 6.67% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212840665 | C -> T | LOC_Os02g21620.1 | splice_region_variant&synonymous_variant ; p.Lys293Lys; LOW | synonymous_codon | Average:6.893; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| vg0212840665 | C -> DEL | LOC_Os02g21620.1 | N | frameshift_variant | Average:6.893; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212840665 | NA | 8.72E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 6.02E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 8.95E-11 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 3.45E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 4.92E-06 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 4.47E-06 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 1.03E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 4.61E-06 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | 1.28E-06 | 1.27E-06 | mr1481 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 3.88E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | 7.08E-07 | 7.10E-07 | mr1562 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | 2.58E-06 | 2.58E-06 | mr1562 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 2.19E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | NA | 2.18E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | 3.30E-06 | 1.59E-06 | mr1895 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212840665 | 4.42E-06 | 2.05E-06 | mr1895 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |