| Variant ID: vg0212787331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12787331 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTTATCAAAGCATTTAATATATTTTGATAGGGGTGGAAACGCAAAATTGATAGGAATGCGTGATTGAGAACATTGCAGCCATTTATCCTTTCTAAGGTC[A/T]
TTTTTTTCCATCTCCTCTCTCCACGCTCCCTGCAAGCACCATTGTGTCTTTCCATTAAAAGGATCCTCTGATTTATTATATAGTTTAGCCACTGACATGT
ACATGTCAGTGGCTAAACTATATAATAAATCAGAGGATCCTTTTAATGGAAAGACACAATGGTGCTTGCAGGGAGCGTGGAGAGAGGAGATGGAAAAAAA[T/A]
GACCTTAGAAAGGATAAATGGCTGCAATGTTCTCAATCACGCATTCCTATCAATTTTGCGTTTCCACCCCTATCAAAATATATTAAATGCTTTGATAAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 2.90% | 1.54% | 62.87% | NA |
| All Indica | 2759 | 3.40% | 0.00% | 1.16% | 95.43% | NA |
| All Japonica | 1512 | 88.00% | 8.50% | 1.59% | 1.85% | NA |
| Aus | 269 | 1.10% | 0.00% | 0.37% | 98.51% | NA |
| Indica I | 595 | 4.90% | 0.00% | 1.34% | 93.78% | NA |
| Indica II | 465 | 4.50% | 0.00% | 0.65% | 94.84% | NA |
| Indica III | 913 | 2.00% | 0.00% | 0.99% | 97.04% | NA |
| Indica Intermediate | 786 | 3.30% | 0.00% | 1.53% | 95.17% | NA |
| Temperate Japonica | 767 | 95.20% | 2.70% | 0.78% | 1.30% | NA |
| Tropical Japonica | 504 | 79.40% | 15.30% | 2.98% | 2.38% | NA |
| Japonica Intermediate | 241 | 83.40% | 12.90% | 1.24% | 2.49% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 15.62% | 9.38% | NA |
| Intermediate | 90 | 51.10% | 7.80% | 1.11% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212787331 | A -> T | LOC_Os02g21550.1 | upstream_gene_variant ; 1337.0bp to feature; MODIFIER | silent_mutation | Average:11.58; most accessible tissue: Callus, score: 69.626 | N | N | N | N |
| vg0212787331 | A -> T | LOC_Os02g21540.1 | downstream_gene_variant ; 4600.0bp to feature; MODIFIER | silent_mutation | Average:11.58; most accessible tissue: Callus, score: 69.626 | N | N | N | N |
| vg0212787331 | A -> T | LOC_Os02g21540-LOC_Os02g21550 | intergenic_region ; MODIFIER | silent_mutation | Average:11.58; most accessible tissue: Callus, score: 69.626 | N | N | N | N |
| vg0212787331 | A -> DEL | N | N | silent_mutation | Average:11.58; most accessible tissue: Callus, score: 69.626 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212787331 | NA | 6.38E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212787331 | NA | 1.21E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212787331 | 1.98E-06 | NA | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |