Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0212006137:

Variant ID: vg0212006137 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12006137
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATAGTGATATTTTCAACCCAAAAGAAGCATATTATCAAAATATATTAAATGTTAGATTTAATAGAACTAATTTAATATTTTAGCTGTTACTAAATTTTT[T/C]
TATAAATTTGGTTAAACATTTGACTAGGAAAAAAATTCAAAAGACTATAATATGAAACGGAGGGAGTAGTCAATGCTAAAACGGAGTTGATAAGCTGATA

Reverse complement sequence

TATCAGCTTATCAACTCCGTTTTAGCATTGACTACTCCCTCCGTTTCATATTATAGTCTTTTGAATTTTTTTCCTAGTCAAATGTTTAACCAAATTTATA[A/G]
AAAAATTTAGTAACAGCTAAAATATTAAATTAGTTCTATTAAATCTAACATTTAATATATTTTGATAATATGCTTCTTTTGGGTTGAAAATATCACTATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	30.50%	0.59%	0.00%	NA
All Indica	2759	98.80%	0.90%	0.33%	0.00%	NA
All Japonica	1512	13.80%	85.10%	1.06%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.30%	0.22%	0.00%	NA
Indica Intermediate	786	98.00%	1.40%	0.64%	0.00%	NA
Temperate Japonica	767	4.30%	95.20%	0.52%	0.00%	NA
Tropical Japonica	504	29.00%	69.80%	1.19%	0.00%	NA
Japonica Intermediate	241	12.40%	85.10%	2.49%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	60.00%	37.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212006137	T -> C	LOC_Os02g20360.1	upstream_gene_variant ; 3504.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0212006137	T -> C	LOC_Os02g20360.2	upstream_gene_variant ; 3504.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0212006137	T -> C	LOC_Os02g20370.1	downstream_gene_variant ; 916.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0212006137	T -> C	LOC_Os02g20380.1	downstream_gene_variant ; 2572.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0212006137	T -> C	LOC_Os02g20380.2	downstream_gene_variant ; 2572.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0212006137	T -> C	LOC_Os02g20380.3	downstream_gene_variant ; 2572.0bp to feature; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0212006137	T -> C	LOC_Os02g20370-LOC_Os02g20380	intergenic_region ; MODIFIER	silent_mutation	Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212006137	NA	1.57E-55	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	6.93E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	1.15E-07	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	1.02E-12	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	8.05E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	3.26E-46	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	7.76E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	6.96E-34	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	5.81E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	2.77E-30	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	1.43E-09	NA	mr1301_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	2.72E-20	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	2.57E-06	NA	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137	NA	1.60E-31	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251