\
| Variant ID: vg0212006137 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 12006137 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATAGTGATATTTTCAACCCAAAAGAAGCATATTATCAAAATATATTAAATGTTAGATTTAATAGAACTAATTTAATATTTTAGCTGTTACTAAATTTTT[T/C]
TATAAATTTGGTTAAACATTTGACTAGGAAAAAAATTCAAAAGACTATAATATGAAACGGAGGGAGTAGTCAATGCTAAAACGGAGTTGATAAGCTGATA
TATCAGCTTATCAACTCCGTTTTAGCATTGACTACTCCCTCCGTTTCATATTATAGTCTTTTGAATTTTTTTCCTAGTCAAATGTTTAACCAAATTTATA[A/G]
AAAAATTTAGTAACAGCTAAAATATTAAATTAGTTCTATTAAATCTAACATTTAATATATTTTGATAATATGCTTCTTTTGGGTTGAAAATATCACTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 30.50% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 0.90% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 13.80% | 85.10% | 1.06% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 4.30% | 95.20% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 29.00% | 69.80% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.40% | 85.10% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0212006137 | T -> C | LOC_Os02g20360.1 | upstream_gene_variant ; 3504.0bp to feature; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0212006137 | T -> C | LOC_Os02g20360.2 | upstream_gene_variant ; 3504.0bp to feature; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0212006137 | T -> C | LOC_Os02g20370.1 | downstream_gene_variant ; 916.0bp to feature; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0212006137 | T -> C | LOC_Os02g20380.1 | downstream_gene_variant ; 2572.0bp to feature; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0212006137 | T -> C | LOC_Os02g20380.2 | downstream_gene_variant ; 2572.0bp to feature; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0212006137 | T -> C | LOC_Os02g20380.3 | downstream_gene_variant ; 2572.0bp to feature; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0212006137 | T -> C | LOC_Os02g20370-LOC_Os02g20380 | intergenic_region ; MODIFIER | silent_mutation | Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0212006137 | NA | 1.57E-55 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 6.93E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | 1.15E-07 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 1.02E-12 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 8.05E-35 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 3.26E-46 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 7.76E-26 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 6.96E-34 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 5.81E-08 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 2.77E-30 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | 1.43E-09 | NA | mr1301_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 2.72E-20 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | 2.57E-06 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0212006137 | NA | 1.60E-31 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |