\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212006137:

Variant ID: vg0212006137 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 12006137
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAGTGATATTTTCAACCCAAAAGAAGCATATTATCAAAATATATTAAATGTTAGATTTAATAGAACTAATTTAATATTTTAGCTGTTACTAAATTTTT[T/C]
TATAAATTTGGTTAAACATTTGACTAGGAAAAAAATTCAAAAGACTATAATATGAAACGGAGGGAGTAGTCAATGCTAAAACGGAGTTGATAAGCTGATA

Reverse complement sequence

TATCAGCTTATCAACTCCGTTTTAGCATTGACTACTCCCTCCGTTTCATATTATAGTCTTTTGAATTTTTTTCCTAGTCAAATGTTTAACCAAATTTATA[A/G]
AAAAATTTAGTAACAGCTAAAATATTAAATTAGTTCTATTAAATCTAACATTTAATATATTTTGATAATATGCTTCTTTTGGGTTGAAAATATCACTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 30.50% 0.59% 0.00% NA
All Indica  2759 98.80% 0.90% 0.33% 0.00% NA
All Japonica  1512 13.80% 85.10% 1.06% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 98.00% 1.40% 0.64% 0.00% NA
Temperate Japonica  767 4.30% 95.20% 0.52% 0.00% NA
Tropical Japonica  504 29.00% 69.80% 1.19% 0.00% NA
Japonica Intermediate  241 12.40% 85.10% 2.49% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0212006137 T -> C LOC_Os02g20360.1 upstream_gene_variant ; 3504.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0212006137 T -> C LOC_Os02g20360.2 upstream_gene_variant ; 3504.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0212006137 T -> C LOC_Os02g20370.1 downstream_gene_variant ; 916.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0212006137 T -> C LOC_Os02g20380.1 downstream_gene_variant ; 2572.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0212006137 T -> C LOC_Os02g20380.2 downstream_gene_variant ; 2572.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0212006137 T -> C LOC_Os02g20380.3 downstream_gene_variant ; 2572.0bp to feature; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0212006137 T -> C LOC_Os02g20370-LOC_Os02g20380 intergenic_region ; MODIFIER silent_mutation Average:41.455; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0212006137 NA 1.57E-55 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 6.93E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 1.15E-07 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 1.02E-12 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 8.05E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 3.26E-46 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 7.76E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 6.96E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 5.81E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 2.77E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 1.43E-09 NA mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 2.72E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 2.57E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212006137 NA 1.60E-31 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251