\
| Variant ID: vg0211826989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11826989 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, T: 0.34, others allele: 0.00, population size: 59. )
AAAATAAACAGCAGCGGACTAGCGGGCCTACGGCTCCATCTTCACAGGCGCTCAACTGGGGTATAAGCCAGGACTCCACCTAAGACTTCTTCTCCAAAGC[A/T]
TCTCTTACTGAAGGGGGGGAAAAGATTGAGCAAGAGTGAGTACAACCACAGTACTCAGCAAGCCACACCGGCGGATGCATGATTAATGCAAGGGGGTACA
TGTACCCCCTTGCATTAATCATGCATCCGCCGGTGTGGCTTGCTGAGTACTGTGGTTGTACTCACTCTTGCTCAATCTTTTCCCCCCCTTCAGTAAGAGA[T/A]
GCTTTGGAGAAGAAGTCTTAGGTGGAGTCCTGGCTTATACCCCAGTTGAGCGCCTGTGAAGATGGAGCCGTAGGCCCGCTAGTCCGCTGCTGTTTATTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 10.10% | 37.13% | 11.26% | NA |
| All Indica | 2759 | 10.90% | 16.70% | 56.87% | 15.51% | NA |
| All Japonica | 1512 | 98.10% | 0.20% | 0.66% | 0.99% | NA |
| Aus | 269 | 7.80% | 4.50% | 58.36% | 29.37% | NA |
| Indica I | 595 | 19.50% | 9.90% | 57.14% | 13.45% | NA |
| Indica II | 465 | 11.20% | 15.50% | 52.26% | 21.08% | NA |
| Indica III | 913 | 3.00% | 23.10% | 60.57% | 13.36% | NA |
| Indica Intermediate | 786 | 13.50% | 15.10% | 55.09% | 16.28% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 97.20% | 0.40% | 0.99% | 1.39% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.40% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 2.20% | 21.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211826989 | A -> T | LOC_Os02g20080.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.068; most accessible tissue: Callus, score: 24.486 | N | N | N | N |
| vg0211826989 | A -> DEL | N | N | silent_mutation | Average:7.068; most accessible tissue: Callus, score: 24.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211826989 | 1.59E-06 | 2.26E-07 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211826989 | NA | 7.91E-30 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211826989 | NA | 3.03E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211826989 | 3.35E-07 | 1.22E-07 | mr1411 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211826989 | NA | 9.40E-23 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211826989 | NA | 8.82E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211826989 | NA | 7.46E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |