Variant ID: vg0211784188 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 11784188 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.15, others allele: 0.00, population size: 109. )
TCACAAATTTTGAATCAAAATGGTTAGATAGTTTATCTGCATGATCAAAAGGCAAATCTGTTCTATCAGAGTTTCAAGAATAGGATGGGTATCTCTTGCT[T/C]
CCCAACAATGGATTTTAACTTGAATGAGCTTTTTGTTCCTAGAACAGATTTGGAGTGCTTGATTGACATGTTTTGCACACAATAGATTGATAGTCTCATC
GATGAGACTATCAATCTATTGTGTGCAAAACATGTCAATCAAGCACTCCAAATCTGTTCTAGGAACAAAAAGCTCATTCAAGTTAAAATCCATTGTTGGG[A/G]
AGCAAGAGATACCCATCCTATTCTTGAAACTCTGATAGAACAGATTTGCCTTTTGATCATGCAGATAAACTATCTAACCATTTTGATTCAAAATTTGTGA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 34.40% | 23.60% | 2.84% | 39.15% | NA |
All Indica | 2759 | 2.90% | 31.00% | 3.99% | 62.09% | NA |
All Japonica | 1512 | 93.50% | 0.20% | 1.12% | 5.16% | NA |
Aus | 269 | 2.20% | 92.20% | 0.37% | 5.20% | NA |
Indica I | 595 | 3.20% | 21.70% | 5.88% | 69.24% | NA |
Indica II | 465 | 4.10% | 35.90% | 3.01% | 56.99% | NA |
Indica III | 913 | 1.90% | 32.30% | 2.08% | 63.75% | NA |
Indica Intermediate | 786 | 3.20% | 33.70% | 5.34% | 57.76% | NA |
Temperate Japonica | 767 | 93.10% | 0.10% | 1.04% | 5.74% | NA |
Tropical Japonica | 504 | 95.60% | 0.20% | 0.79% | 3.37% | NA |
Japonica Intermediate | 241 | 90.50% | 0.40% | 2.07% | 7.05% | NA |
VI/Aromatic | 96 | 84.40% | 1.00% | 5.21% | 9.38% | NA |
Intermediate | 90 | 50.00% | 8.90% | 1.11% | 40.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0211784188 | T -> DEL | N | N | silent_mutation | Average:11.85; most accessible tissue: Callus, score: 30.763 | N | N | N | N |
vg0211784188 | T -> C | LOC_Os02g20010.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.85; most accessible tissue: Callus, score: 30.763 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0211784188 | 2.72E-06 | 7.56E-07 | mr1538 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0211784188 | NA | 7.87E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0211784188 | NA | 2.70E-08 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |