\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211533026:

Variant ID: vg0211533026 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11533026
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCCTCTCATCTGCTGCTCTCCCTCCTCGACCACCCACCGACGGCGCCGCTCCCTCTCCGCCGGTCCCCCTCCTCGTCCCTCCACCGAGCCCACCGG[T/C]
GATGGATCCAACTCCCCCGAACTCGCTGGCGATGGATCGGCCTTCTCTGAGCTTGCCGACGACAGATCCACCTCCCCCGAGCTCGGTCCAGCCGTCGTCG

Reverse complement sequence

CGACGACGGCTGGACCGAGCTCGGGGGAGGTGGATCTGTCGTCGGCAAGCTCAGAGAAGGCCGATCCATCGCCAGCGAGTTCGGGGGAGTTGGATCCATC[A/G]
CCGGTGGGCTCGGTGGAGGGACGAGGAGGGGGACCGGCGGAGAGGGAGCGGCGCCGTCGGTGGGTGGTCGAGGAGGGAGAGCAGCAGATGAGAGGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 33.60% 21.43% 2.73% NA
All Indica  2759 65.50% 2.30% 28.23% 3.99% NA
All Japonica  1512 8.10% 91.10% 0.73% 0.07% NA
Aus  269 17.50% 1.50% 75.09% 5.95% NA
Indica I  595 67.20% 1.20% 26.89% 4.71% NA
Indica II  465 58.70% 3.40% 33.12% 4.73% NA
Indica III  913 69.00% 2.10% 26.40% 2.52% NA
Indica Intermediate  786 64.00% 2.80% 28.50% 4.71% NA
Temperate Japonica  767 11.30% 88.50% 0.13% 0.00% NA
Tropical Japonica  504 1.80% 96.40% 1.59% 0.20% NA
Japonica Intermediate  241 10.80% 88.40% 0.83% 0.00% NA
VI/Aromatic  96 0.00% 99.00% 0.00% 1.04% NA
Intermediate  90 23.30% 52.20% 23.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211533026 T -> DEL N N silent_mutation Average:13.824; most accessible tissue: Callus, score: 21.239 N N N N
vg0211533026 T -> C LOC_Os02g19710.1 downstream_gene_variant ; 3073.0bp to feature; MODIFIER silent_mutation Average:13.824; most accessible tissue: Callus, score: 21.239 N N N N
vg0211533026 T -> C LOC_Os02g19720.1 downstream_gene_variant ; 4401.0bp to feature; MODIFIER silent_mutation Average:13.824; most accessible tissue: Callus, score: 21.239 N N N N
vg0211533026 T -> C LOC_Os02g19710-LOC_Os02g19720 intergenic_region ; MODIFIER silent_mutation Average:13.824; most accessible tissue: Callus, score: 21.239 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211533026 NA 3.64E-13 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 3.78E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.21E-47 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 5.73E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 3.92E-13 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.68E-27 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 2.03E-50 mr1152 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.91E-56 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 6.15E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 2.15E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 8.40E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 2.09E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 5.66E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 8.81E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.66E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 4.18E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 3.33E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 4.01E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 7.99E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 2.53E-101 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.41E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.35E-33 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 8.88E-43 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.60E-15 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 8.04E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.30E-41 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 6.26E-51 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.46E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.42E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.28E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211533026 NA 1.20E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251