\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0211208908:

Variant ID: vg0211208908 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 11208908
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTACTCCATCCGTCCCGTAAAAAAAAGTACCTATTACGGGATGTATCACATCCTAGTACATCGTAACACTATGAATCTAGATAAGAGCTACCTCTTCT[T/C]
CAGATTCGTAGTAACAGGAAATGTCACATTTCGTACTAGATTTATTTTTTATGAGACAAAGAGTAGTTCATTCATAAATAGTAGCGGATATAAGATGGAT

Reverse complement sequence

ATCCATCTTATATCCGCTACTATTTATGAATGAACTACTCTTTGTCTCATAAAAAATAAATCTAGTACGAAATGTGACATTTCCTGTTACTACGAATCTG[A/G]
AGAAGAGGTAGCTCTTATCTAGATTCATAGTGTTACGATGTACTAGGATGTGATACATCCCGTAATAGGTACTTTTTTTTACGGGACGGATGGAGTACCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 31.90% 0.23% 1.61% NA
All Indica  2759 95.90% 1.00% 0.36% 2.75% NA
All Japonica  1512 10.60% 89.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.20% 2.20% 0.00% 0.65% NA
Indica III  913 91.20% 0.70% 0.99% 7.12% NA
Indica Intermediate  786 97.60% 1.30% 0.13% 1.02% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 26.20% 73.80% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0211208908 T -> DEL N N silent_mutation Average:65.76; most accessible tissue: Callus, score: 81.214 N N N N
vg0211208908 T -> C LOC_Os02g19210.1 downstream_gene_variant ; 3027.0bp to feature; MODIFIER silent_mutation Average:65.76; most accessible tissue: Callus, score: 81.214 N N N N
vg0211208908 T -> C LOC_Os02g19220.1 downstream_gene_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:65.76; most accessible tissue: Callus, score: 81.214 N N N N
vg0211208908 T -> C LOC_Os02g19210.2 downstream_gene_variant ; 3027.0bp to feature; MODIFIER silent_mutation Average:65.76; most accessible tissue: Callus, score: 81.214 N N N N
vg0211208908 T -> C LOC_Os02g19220.2 downstream_gene_variant ; 129.0bp to feature; MODIFIER silent_mutation Average:65.76; most accessible tissue: Callus, score: 81.214 N N N N
vg0211208908 T -> C LOC_Os02g19210-LOC_Os02g19220 intergenic_region ; MODIFIER silent_mutation Average:65.76; most accessible tissue: Callus, score: 81.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0211208908 NA 2.18E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 5.56E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 3.34E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 2.97E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 2.74E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 3.01E-10 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 2.73E-06 2.16E-09 mr1785_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 4.84E-10 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 2.58E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 5.12E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 2.75E-19 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 8.44E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 3.33E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0211208908 NA 6.56E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251