\
| Variant ID: vg0211208908 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 11208908 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 96. )
AGGTACTCCATCCGTCCCGTAAAAAAAAGTACCTATTACGGGATGTATCACATCCTAGTACATCGTAACACTATGAATCTAGATAAGAGCTACCTCTTCT[T/C]
CAGATTCGTAGTAACAGGAAATGTCACATTTCGTACTAGATTTATTTTTTATGAGACAAAGAGTAGTTCATTCATAAATAGTAGCGGATATAAGATGGAT
ATCCATCTTATATCCGCTACTATTTATGAATGAACTACTCTTTGTCTCATAAAAAATAAATCTAGTACGAAATGTGACATTTCCTGTTACTACGAATCTG[A/G]
AGAAGAGGTAGCTCTTATCTAGATTCATAGTGTTACGATGTACTAGGATGTGATACATCCCGTAATAGGTACTTTTTTTTACGGGACGGATGGAGTACCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 31.90% | 0.23% | 1.61% | NA |
| All Indica | 2759 | 95.90% | 1.00% | 0.36% | 2.75% | NA |
| All Japonica | 1512 | 10.60% | 89.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 91.20% | 0.70% | 0.99% | 7.12% | NA |
| Indica Intermediate | 786 | 97.60% | 1.30% | 0.13% | 1.02% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.20% | 73.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0211208908 | T -> DEL | N | N | silent_mutation | Average:65.76; most accessible tissue: Callus, score: 81.214 | N | N | N | N |
| vg0211208908 | T -> C | LOC_Os02g19210.1 | downstream_gene_variant ; 3027.0bp to feature; MODIFIER | silent_mutation | Average:65.76; most accessible tissue: Callus, score: 81.214 | N | N | N | N |
| vg0211208908 | T -> C | LOC_Os02g19220.1 | downstream_gene_variant ; 128.0bp to feature; MODIFIER | silent_mutation | Average:65.76; most accessible tissue: Callus, score: 81.214 | N | N | N | N |
| vg0211208908 | T -> C | LOC_Os02g19210.2 | downstream_gene_variant ; 3027.0bp to feature; MODIFIER | silent_mutation | Average:65.76; most accessible tissue: Callus, score: 81.214 | N | N | N | N |
| vg0211208908 | T -> C | LOC_Os02g19220.2 | downstream_gene_variant ; 129.0bp to feature; MODIFIER | silent_mutation | Average:65.76; most accessible tissue: Callus, score: 81.214 | N | N | N | N |
| vg0211208908 | T -> C | LOC_Os02g19210-LOC_Os02g19220 | intergenic_region ; MODIFIER | silent_mutation | Average:65.76; most accessible tissue: Callus, score: 81.214 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0211208908 | NA | 2.18E-12 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 5.56E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 3.34E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 2.97E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 2.74E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 3.01E-10 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | 2.73E-06 | 2.16E-09 | mr1785_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 4.84E-10 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 2.58E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 5.12E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 2.75E-19 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 8.44E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 3.33E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0211208908 | NA | 6.56E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |