\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210314544:

Variant ID: vg0210314544 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10314544
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGTTCGGTGGTCTAACCGGTGAAACACCACCGGTCGGACCGGCTGCATTGCGGCAGTCAGACTGCCGGAGTAGCGGCGGTCAAACCGGCGGTGGCTT[T/C]
AGGCGATGACAGTTGATCTCTGCGGTCAGACCGGAGAATCAATCTCGGTCAGACCGACTGTTTCCAGGTGGTTAGACCGCACATCTACATTGGTCAGACC

Reverse complement sequence

GGTCTGACCAATGTAGATGTGCGGTCTAACCACCTGGAAACAGTCGGTCTGACCGAGATTGATTCTCCGGTCTGACCGCAGAGATCAACTGTCATCGCCT[A/G]
AAGCCACCGCCGGTTTGACCGCCGCTACTCCGGCAGTCTGACTGCCGCAATGCAGCCGGTCCGACCGGTGGTGTTTCACCGGTTAGACCACCGAACCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.70% 0.06% 0.00% NA
All Indica  2759 97.00% 2.90% 0.11% 0.00% NA
All Japonica  1512 3.40% 96.60% 0.00% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 97.50% 2.40% 0.11% 0.00% NA
Indica Intermediate  786 95.20% 4.70% 0.13% 0.00% NA
Temperate Japonica  767 4.40% 95.60% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210314544 T -> C LOC_Os02g17830.1 downstream_gene_variant ; 370.0bp to feature; MODIFIER silent_mutation Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N
vg0210314544 T -> C LOC_Os02g17840.1 downstream_gene_variant ; 4934.0bp to feature; MODIFIER silent_mutation Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N
vg0210314544 T -> C LOC_Os02g17820-LOC_Os02g17830 intergenic_region ; MODIFIER silent_mutation Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210314544 NA 5.12E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 NA 3.28E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 NA 1.32E-21 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 NA 3.98E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 6.61E-08 NA mr1015_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 9.21E-07 9.21E-07 mr1015_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 NA 5.05E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 NA 8.04E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544 NA 1.31E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251