| Variant ID: vg0210314544 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10314544 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 99. )
TCGGGTTCGGTGGTCTAACCGGTGAAACACCACCGGTCGGACCGGCTGCATTGCGGCAGTCAGACTGCCGGAGTAGCGGCGGTCAAACCGGCGGTGGCTT[T/C]
AGGCGATGACAGTTGATCTCTGCGGTCAGACCGGAGAATCAATCTCGGTCAGACCGACTGTTTCCAGGTGGTTAGACCGCACATCTACATTGGTCAGACC
GGTCTGACCAATGTAGATGTGCGGTCTAACCACCTGGAAACAGTCGGTCTGACCGAGATTGATTCTCCGGTCTGACCGCAGAGATCAACTGTCATCGCCT[A/G]
AAGCCACCGCCGGTTTGACCGCCGCTACTCCGGCAGTCTGACTGCCGCAATGCAGCCGGTCCGACCGGTGGTGTTTCACCGGTTAGACCACCGAACCCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 2.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.40% | 41.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210314544 | T -> C | LOC_Os02g17830.1 | downstream_gene_variant ; 370.0bp to feature; MODIFIER | silent_mutation | Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg0210314544 | T -> C | LOC_Os02g17840.1 | downstream_gene_variant ; 4934.0bp to feature; MODIFIER | silent_mutation | Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg0210314544 | T -> C | LOC_Os02g17820-LOC_Os02g17830 | intergenic_region ; MODIFIER | silent_mutation | Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210314544 | NA | 5.12E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | NA | 3.28E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | NA | 1.32E-21 | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | NA | 3.98E-06 | mr1006_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | 6.61E-08 | NA | mr1015_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | 9.21E-07 | 9.21E-07 | mr1015_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | NA | 5.05E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | NA | 8.04E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210314544 | NA | 1.31E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |