Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0210314544:

Variant ID: vg0210314544 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10314544
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGGTTCGGTGGTCTAACCGGTGAAACACCACCGGTCGGACCGGCTGCATTGCGGCAGTCAGACTGCCGGAGTAGCGGCGGTCAAACCGGCGGTGGCTT[T/C]
AGGCGATGACAGTTGATCTCTGCGGTCAGACCGGAGAATCAATCTCGGTCAGACCGACTGTTTCCAGGTGGTTAGACCGCACATCTACATTGGTCAGACC

Reverse complement sequence

GGTCTGACCAATGTAGATGTGCGGTCTAACCACCTGGAAACAGTCGGTCTGACCGAGATTGATTCTCCGGTCTGACCGCAGAGATCAACTGTCATCGCCT[A/G]
AAGCCACCGCCGGTTTGACCGCCGCTACTCCGGCAGTCTGACTGCCGCAATGCAGCCGGTCCGACCGGTGGTGTTTCACCGGTTAGACCACCGAACCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.70%	0.06%	0.00%	NA
All Indica	2759	97.00%	2.90%	0.11%	0.00%	NA
All Japonica	1512	3.40%	96.60%	0.00%	0.00%	NA
Aus	269	58.40%	41.60%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	97.50%	2.40%	0.11%	0.00%	NA
Indica Intermediate	786	95.20%	4.70%	0.13%	0.00%	NA
Temperate Japonica	767	4.40%	95.60%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210314544	T -> C	LOC_Os02g17830.1	downstream_gene_variant ; 370.0bp to feature; MODIFIER	silent_mutation	Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0210314544	T -> C	LOC_Os02g17840.1	downstream_gene_variant ; 4934.0bp to feature; MODIFIER	silent_mutation	Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0210314544	T -> C	LOC_Os02g17820-LOC_Os02g17830	intergenic_region ; MODIFIER	silent_mutation	Average:63.12; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210314544	NA	5.12E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	NA	3.28E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	NA	1.32E-21	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	NA	3.98E-06	mr1006_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	6.61E-08	NA	mr1015_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	9.21E-07	9.21E-07	mr1015_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	NA	5.05E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	NA	8.04E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210314544	NA	1.31E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251