\
| Variant ID: vg0210038513 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10038513 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 73. )
GGGGTGAGACTAATCACGGTGAATCTGGTTGATCGCCCATAACCGCGGGCATGGCTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACAACTATACCCA[C/T]
AAGACACGATTCCACACATGTCGCCATGCCCCGAAGTATCACCATGATACTGCGAAGGGGGAAATCGTGACAAGACCCTCCGCATAACCCTCCCCTAACC
GGTTAGGGGAGGGTTATGCGGAGGGTCTTGTCACGATTTCCCCCTTCGCAGTATCATGGTGATACTTCGGGGCATGGCGACATGTGTGGAATCGTGTCTT[G/A]
TGGGTATAGTTGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGCCATGCCCGCGGTTATGGGCGATCAACCAGATTCACCGTGATTAGTCTCACCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 3.20% | 12.46% | 11.85% | NA |
| All Indica | 2759 | 53.80% | 5.40% | 21.02% | 19.79% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 42.50% | 3.20% | 21.51% | 32.77% | NA |
| Indica II | 465 | 46.20% | 4.50% | 25.38% | 23.87% | NA |
| Indica III | 913 | 68.80% | 7.80% | 18.18% | 5.26% | NA |
| Indica Intermediate | 786 | 49.50% | 4.70% | 21.37% | 24.43% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 3.30% | 10.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210038513 | C -> T | LOC_Os02g17450.1 | upstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg0210038513 | C -> T | LOC_Os02g17460.1 | downstream_gene_variant ; 3965.0bp to feature; MODIFIER | silent_mutation | Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg0210038513 | C -> T | LOC_Os02g17440.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg0210038513 | C -> DEL | N | N | silent_mutation | Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210038513 | NA | 2.67E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | NA | 2.09E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | NA | 4.22E-06 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | 1.33E-07 | 1.98E-07 | mr1310 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | NA | 3.76E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | 4.49E-06 | 4.49E-06 | mr1360 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | 2.76E-06 | 6.81E-06 | mr1669 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | NA | 3.48E-06 | mr1923 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210038513 | NA | 1.15E-06 | mr1923 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |