\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210038513:

Variant ID: vg0210038513 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10038513
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGTGAGACTAATCACGGTGAATCTGGTTGATCGCCCATAACCGCGGGCATGGCTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACAACTATACCCA[C/T]
AAGACACGATTCCACACATGTCGCCATGCCCCGAAGTATCACCATGATACTGCGAAGGGGGAAATCGTGACAAGACCCTCCGCATAACCCTCCCCTAACC

Reverse complement sequence

GGTTAGGGGAGGGTTATGCGGAGGGTCTTGTCACGATTTCCCCCTTCGCAGTATCATGGTGATACTTCGGGGCATGGCGACATGTGTGGAATCGTGTCTT[G/A]
TGGGTATAGTTGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGCCATGCCCGCGGTTATGGGCGATCAACCAGATTCACCGTGATTAGTCTCACCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 3.20% 12.46% 11.85% NA
All Indica  2759 53.80% 5.40% 21.02% 19.79% NA
All Japonica  1512 99.60% 0.00% 0.00% 0.40% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 42.50% 3.20% 21.51% 32.77% NA
Indica II  465 46.20% 4.50% 25.38% 23.87% NA
Indica III  913 68.80% 7.80% 18.18% 5.26% NA
Indica Intermediate  786 49.50% 4.70% 21.37% 24.43% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 3.30% 10.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210038513 C -> T LOC_Os02g17450.1 upstream_gene_variant ; 1701.0bp to feature; MODIFIER silent_mutation Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N
vg0210038513 C -> T LOC_Os02g17460.1 downstream_gene_variant ; 3965.0bp to feature; MODIFIER silent_mutation Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N
vg0210038513 C -> T LOC_Os02g17440.1 intron_variant ; MODIFIER silent_mutation Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N
vg0210038513 C -> DEL N N silent_mutation Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210038513 NA 2.67E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 NA 2.09E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 NA 4.22E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 1.33E-07 1.98E-07 mr1310 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 NA 3.76E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 4.49E-06 4.49E-06 mr1360 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 2.76E-06 6.81E-06 mr1669 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 NA 3.48E-06 mr1923 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513 NA 1.15E-06 mr1923 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251