Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0210038513:

Variant ID: vg0210038513 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 10038513
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGTGAGACTAATCACGGTGAATCTGGTTGATCGCCCATAACCGCGGGCATGGCTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACAACTATACCCA[C/T]
AAGACACGATTCCACACATGTCGCCATGCCCCGAAGTATCACCATGATACTGCGAAGGGGGAAATCGTGACAAGACCCTCCGCATAACCCTCCCCTAACC

Reverse complement sequence

GGTTAGGGGAGGGTTATGCGGAGGGTCTTGTCACGATTTCCCCCTTCGCAGTATCATGGTGATACTTCGGGGCATGGCGACATGTGTGGAATCGTGTCTT[G/A]
TGGGTATAGTTGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGCCATGCCCGCGGTTATGGGCGATCAACCAGATTCACCGTGATTAGTCTCACCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	3.20%	12.46%	11.85%	NA
All Indica	2759	53.80%	5.40%	21.02%	19.79%	NA
All Japonica	1512	99.60%	0.00%	0.00%	0.40%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	42.50%	3.20%	21.51%	32.77%	NA
Indica II	465	46.20%	4.50%	25.38%	23.87%	NA
Indica III	913	68.80%	7.80%	18.18%	5.26%	NA
Indica Intermediate	786	49.50%	4.70%	21.37%	24.43%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	3.30%	10.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0210038513	C -> T	LOC_Os02g17450.1	upstream_gene_variant ; 1701.0bp to feature; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0210038513	C -> T	LOC_Os02g17460.1	downstream_gene_variant ; 3965.0bp to feature; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0210038513	C -> T	LOC_Os02g17440.1	intron_variant ; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0210038513	C -> DEL	N	N	silent_mutation	Average:35.792; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0210038513	NA	2.67E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	NA	2.09E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	NA	4.22E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	1.33E-07	1.98E-07	mr1310	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	NA	3.76E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	4.49E-06	4.49E-06	mr1360	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	2.76E-06	6.81E-06	mr1669	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	NA	3.48E-06	mr1923	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210038513	NA	1.15E-06	mr1923	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251