\
| Variant ID: vg0209742252 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9742252 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGAGACCGCGCAGCCCCCCTTTGCCGGTTCGGCCGGGGCCCTGGGTGAGATTCTAAGCTCCTGGTCTGTGTGTGGAAGGTCCGCGAGACTGGAAACACA[C/T]
AAGACACGGGCGATGTATACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTGTTTTGGTGGATCTATGTATGAAGAAGCTACAAAAGAGCTG
CAGCTCTTTTGTAGCTTCTTCATACATAGATCCACCAAAACACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTATACATCGCCCGTGTCTT[G/A]
TGTGTTTCCAGTCTCGCGGACCTTCCACACACAGACCAGGAGCTTAGAATCTCACCCAGGGCCCCGGCCGAACCGGCAAAGGGGGGCTGCGCGGTCTCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 27.80% | 10.83% | 29.12% | NA |
| All Indica | 2759 | 5.00% | 42.90% | 15.44% | 36.68% | NA |
| All Japonica | 1512 | 81.50% | 3.60% | 2.98% | 11.90% | NA |
| Aus | 269 | 20.80% | 14.10% | 8.18% | 56.88% | NA |
| Indica I | 595 | 9.60% | 40.50% | 20.34% | 29.58% | NA |
| Indica II | 465 | 6.70% | 38.10% | 13.55% | 41.72% | NA |
| Indica III | 913 | 0.50% | 49.00% | 9.31% | 41.18% | NA |
| Indica Intermediate | 786 | 5.60% | 40.60% | 19.97% | 33.84% | NA |
| Temperate Japonica | 767 | 84.90% | 2.10% | 3.13% | 9.91% | NA |
| Tropical Japonica | 504 | 77.20% | 5.40% | 2.38% | 15.08% | NA |
| Japonica Intermediate | 241 | 80.10% | 4.60% | 3.73% | 11.62% | NA |
| VI/Aromatic | 96 | 66.70% | 19.80% | 2.08% | 11.46% | NA |
| Intermediate | 90 | 36.70% | 22.20% | 18.89% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209742252 | C -> T | LOC_Os02g17040.1 | upstream_gene_variant ; 372.0bp to feature; MODIFIER | silent_mutation | Average:39.229; most accessible tissue: Zhenshan97 root, score: 79.185 | N | N | N | N |
| vg0209742252 | C -> T | LOC_Os02g17050.1 | downstream_gene_variant ; 2802.0bp to feature; MODIFIER | silent_mutation | Average:39.229; most accessible tissue: Zhenshan97 root, score: 79.185 | N | N | N | N |
| vg0209742252 | C -> T | LOC_Os02g17030-LOC_Os02g17040 | intergenic_region ; MODIFIER | silent_mutation | Average:39.229; most accessible tissue: Zhenshan97 root, score: 79.185 | N | N | N | N |
| vg0209742252 | C -> DEL | N | N | silent_mutation | Average:39.229; most accessible tissue: Zhenshan97 root, score: 79.185 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209742252 | 3.97E-06 | NA | mr1073 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | NA | 6.02E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | 1.34E-06 | NA | mr1583 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | NA | 5.83E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | 9.09E-06 | NA | mr1630 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | 3.61E-06 | 3.61E-06 | mr1714 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | NA | 1.39E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209742252 | 1.01E-07 | 1.95E-07 | mr1750_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |