\
| Variant ID: vg0209234495 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 9234495 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )
ACTTTTCAATTCCTTTTATCTGAGTTATCAAATAGAGTATTACATATCTAATGTAACAAGTTAGTAAGGAATAGTGATGAATCTAAAGGCACAATGTAGC[A/T]
TACTGTATTATTGAGGTCTTTATCTTTGTCGTAGTAGCTCTTGTCCATGCGCATCGAGTCTAGTATTTGAATTTTTTCTTTAGCACCATTGAGAACAGCC
GGCTGTTCTCAATGGTGCTAAAGAAAAAATTCAAATACTAGACTCGATGCGCATGGACAAGAGCTACTACGACAAAGATAAAGACCTCAATAATACAGTA[T/A]
GCTACATTGTGCCTTTAGATTCATCACTATTCCTTACTAACTTGTTACATTAGATATGTAATACTCTATTTGATAACTCAGATAAAAGGAATTGAAAAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.80% | 10.70% | 2.45% | 9.01% | NA |
| All Indica | 2759 | 64.50% | 17.50% | 3.81% | 14.21% | NA |
| All Japonica | 1512 | 98.50% | 0.00% | 0.07% | 1.46% | NA |
| Aus | 269 | 87.70% | 8.60% | 3.72% | 0.00% | NA |
| Indica I | 595 | 58.30% | 15.50% | 2.52% | 23.70% | NA |
| Indica II | 465 | 76.30% | 5.20% | 3.87% | 14.62% | NA |
| Indica III | 913 | 56.80% | 30.10% | 5.91% | 7.12% | NA |
| Indica Intermediate | 786 | 71.10% | 11.60% | 2.29% | 15.01% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.13% | 1.17% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 1.10% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0209234495 | A -> T | LOC_Os02g16240.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:7.903; most accessible tissue: Callus, score: 32.151 | N | N | N | N |
| vg0209234495 | A -> T | LOC_Os02g16250.1 | upstream_gene_variant ; 3944.0bp to feature; MODIFIER | silent_mutation | Average:7.903; most accessible tissue: Callus, score: 32.151 | N | N | N | N |
| vg0209234495 | A -> DEL | N | N | silent_mutation | Average:7.903; most accessible tissue: Callus, score: 32.151 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0209234495 | NA | 1.22E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209234495 | 3.96E-06 | NA | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209234495 | 1.05E-06 | NA | mr1962 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209234495 | 8.52E-06 | NA | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0209234495 | 8.75E-06 | NA | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |