\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0209234495:

Variant ID: vg0209234495 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 9234495
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTTCAATTCCTTTTATCTGAGTTATCAAATAGAGTATTACATATCTAATGTAACAAGTTAGTAAGGAATAGTGATGAATCTAAAGGCACAATGTAGC[A/T]
TACTGTATTATTGAGGTCTTTATCTTTGTCGTAGTAGCTCTTGTCCATGCGCATCGAGTCTAGTATTTGAATTTTTTCTTTAGCACCATTGAGAACAGCC

Reverse complement sequence

GGCTGTTCTCAATGGTGCTAAAGAAAAAATTCAAATACTAGACTCGATGCGCATGGACAAGAGCTACTACGACAAAGATAAAGACCTCAATAATACAGTA[T/A]
GCTACATTGTGCCTTTAGATTCATCACTATTCCTTACTAACTTGTTACATTAGATATGTAATACTCTATTTGATAACTCAGATAAAAGGAATTGAAAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 10.70% 2.45% 9.01% NA
All Indica  2759 64.50% 17.50% 3.81% 14.21% NA
All Japonica  1512 98.50% 0.00% 0.07% 1.46% NA
Aus  269 87.70% 8.60% 3.72% 0.00% NA
Indica I  595 58.30% 15.50% 2.52% 23.70% NA
Indica II  465 76.30% 5.20% 3.87% 14.62% NA
Indica III  913 56.80% 30.10% 5.91% 7.12% NA
Indica Intermediate  786 71.10% 11.60% 2.29% 15.01% NA
Temperate Japonica  767 98.70% 0.00% 0.13% 1.17% NA
Tropical Japonica  504 98.20% 0.00% 0.00% 1.79% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 1.10% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0209234495 A -> T LOC_Os02g16240.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:7.903; most accessible tissue: Callus, score: 32.151 N N N N
vg0209234495 A -> T LOC_Os02g16250.1 upstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:7.903; most accessible tissue: Callus, score: 32.151 N N N N
vg0209234495 A -> DEL N N silent_mutation Average:7.903; most accessible tissue: Callus, score: 32.151 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0209234495 NA 1.22E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209234495 3.96E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209234495 1.05E-06 NA mr1962 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209234495 8.52E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0209234495 8.75E-06 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251