\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208756515:

Variant ID: vg0208756515 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8756515
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGTGGCTTAACTACACATTTACGAGGAAGCGTTGGTAAAGGTGGGTAGGCGAAAAACACCATGACACAAAGAGGCGGAATTCAATGCTAACTTATGA[T/C]
GTGGAATGACGCATTAATCGTCATACAATATAAGGAGAGGGGAGGTGAACCCAGCTCAACCAAATCATCAGGAGCCCTAATACGATCATGCAACCAAACA

Reverse complement sequence

TGTTTGGTTGCATGATCGTATTAGGGCTCCTGATGATTTGGTTGAGCTGGGTTCACCTCCCCTCTCCTTATATTGTATGACGATTAATGCGTCATTCCAC[A/G]
TCATAAGTTAGCATTGAATTCCGCCTCTTTGTGTCATGGTGTTTTTCGCCTACCCACCTTTACCAACGCTTCCTCGTAAATGTGTAGTTAAGCCACACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 1.70% 1.63% 0.00% NA
All Indica  2759 99.80% 0.10% 0.11% 0.00% NA
All Japonica  1512 90.10% 5.10% 4.76% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 81.00% 10.00% 9.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208756515 T -> C LOC_Os02g15580.1 upstream_gene_variant ; 2400.0bp to feature; MODIFIER silent_mutation Average:72.133; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N
vg0208756515 T -> C LOC_Os02g15594.1 upstream_gene_variant ; 3487.0bp to feature; MODIFIER silent_mutation Average:72.133; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N
vg0208756515 T -> C LOC_Os02g15580.3 upstream_gene_variant ; 474.0bp to feature; MODIFIER silent_mutation Average:72.133; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N
vg0208756515 T -> C LOC_Os02g15580.2 upstream_gene_variant ; 474.0bp to feature; MODIFIER silent_mutation Average:72.133; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N
vg0208756515 T -> C LOC_Os02g15580-LOC_Os02g15594 intergenic_region ; MODIFIER silent_mutation Average:72.133; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208756515 NA 9.18E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756515 3.69E-06 3.69E-06 mr1307 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208756515 NA 2.64E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251