\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208608994:

Variant ID: vg0208608994 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8608994
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCGTACAAGGTGTTCGACCCTGTGACCAGGCGCATGCAGGTGTCACGCGATGTCATCTTCGACGAAGGCGCGAGCTGGGACTGGGGCGCTAAAGTGAC[C/T]
GAGTCTGGCCTTGAACAGACGGAGTTTTCCGTCGAGTATGTGCTGACACAGGTGAGCGGTGGTGGTCGCGGCGCTCAGGAGGAAAACTCATCGTCAAGCT

Reverse complement sequence

AGCTTGACGATGAGTTTTCCTCCTGAGCGCCGCGACCACCACCGCTCACCTGTGTCAGCACATACTCGACGGAAAACTCCGTCTGTTCAAGGCCAGACTC[G/A]
GTCACTTTAGCGCCCCAGTCCCAGCTCGCGCCTTCGTCGAAGATGACATCGCGTGACACCTGCATGCGCCTGGTCACAGGGTCGAACACCTTGTACGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 8.30% 1.04% 54.10% NA
All Indica  2759 21.80% 13.60% 1.45% 63.14% NA
All Japonica  1512 57.50% 0.20% 0.33% 41.93% NA
Aus  269 72.10% 0.40% 1.12% 26.39% NA
Indica I  595 22.20% 8.70% 2.02% 67.06% NA
Indica II  465 18.50% 24.50% 1.08% 55.91% NA
Indica III  913 18.90% 13.00% 0.77% 67.25% NA
Indica Intermediate  786 26.70% 11.60% 2.04% 59.67% NA
Temperate Japonica  767 81.90% 0.00% 0.13% 17.99% NA
Tropical Japonica  504 30.80% 0.40% 0.40% 68.45% NA
Japonica Intermediate  241 36.10% 0.40% 0.83% 62.66% NA
VI/Aromatic  96 24.00% 1.00% 1.04% 73.96% NA
Intermediate  90 42.20% 14.40% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208608994 C -> T LOC_Os02g15380.1 upstream_gene_variant ; 3071.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 49.554 N N N N
vg0208608994 C -> T LOC_Os02g15390.1 upstream_gene_variant ; 816.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 49.554 N N N N
vg0208608994 C -> T LOC_Os02g15400.1 upstream_gene_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 49.554 N N N N
vg0208608994 C -> T LOC_Os02g15410.1 downstream_gene_variant ; 3365.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 49.554 N N N N
vg0208608994 C -> T LOC_Os02g15390-LOC_Os02g15400 intergenic_region ; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 49.554 N N N N
vg0208608994 C -> DEL N N silent_mutation Average:12.056; most accessible tissue: Callus, score: 49.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208608994 4.42E-06 4.43E-06 mr1160 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 6.39E-06 NA mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 NA 1.33E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 NA 5.83E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 NA 2.56E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 2.12E-06 NA mr1590 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 5.32E-06 NA mr1623 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 4.92E-06 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 NA 5.82E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 NA 5.62E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208608994 5.62E-06 5.62E-06 mr1827 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251