\
| Variant ID: vg0208608994 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8608994 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.03, others allele: 0.00, population size: 36. )
AGGCGTACAAGGTGTTCGACCCTGTGACCAGGCGCATGCAGGTGTCACGCGATGTCATCTTCGACGAAGGCGCGAGCTGGGACTGGGGCGCTAAAGTGAC[C/T]
GAGTCTGGCCTTGAACAGACGGAGTTTTCCGTCGAGTATGTGCTGACACAGGTGAGCGGTGGTGGTCGCGGCGCTCAGGAGGAAAACTCATCGTCAAGCT
AGCTTGACGATGAGTTTTCCTCCTGAGCGCCGCGACCACCACCGCTCACCTGTGTCAGCACATACTCGACGGAAAACTCCGTCTGTTCAAGGCCAGACTC[G/A]
GTCACTTTAGCGCCCCAGTCCCAGCTCGCGCCTTCGTCGAAGATGACATCGCGTGACACCTGCATGCGCCTGGTCACAGGGTCGAACACCTTGTACGCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.50% | 8.30% | 1.04% | 54.10% | NA |
| All Indica | 2759 | 21.80% | 13.60% | 1.45% | 63.14% | NA |
| All Japonica | 1512 | 57.50% | 0.20% | 0.33% | 41.93% | NA |
| Aus | 269 | 72.10% | 0.40% | 1.12% | 26.39% | NA |
| Indica I | 595 | 22.20% | 8.70% | 2.02% | 67.06% | NA |
| Indica II | 465 | 18.50% | 24.50% | 1.08% | 55.91% | NA |
| Indica III | 913 | 18.90% | 13.00% | 0.77% | 67.25% | NA |
| Indica Intermediate | 786 | 26.70% | 11.60% | 2.04% | 59.67% | NA |
| Temperate Japonica | 767 | 81.90% | 0.00% | 0.13% | 17.99% | NA |
| Tropical Japonica | 504 | 30.80% | 0.40% | 0.40% | 68.45% | NA |
| Japonica Intermediate | 241 | 36.10% | 0.40% | 0.83% | 62.66% | NA |
| VI/Aromatic | 96 | 24.00% | 1.00% | 1.04% | 73.96% | NA |
| Intermediate | 90 | 42.20% | 14.40% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208608994 | C -> T | LOC_Os02g15380.1 | upstream_gene_variant ; 3071.0bp to feature; MODIFIER | silent_mutation | Average:12.056; most accessible tissue: Callus, score: 49.554 | N | N | N | N |
| vg0208608994 | C -> T | LOC_Os02g15390.1 | upstream_gene_variant ; 816.0bp to feature; MODIFIER | silent_mutation | Average:12.056; most accessible tissue: Callus, score: 49.554 | N | N | N | N |
| vg0208608994 | C -> T | LOC_Os02g15400.1 | upstream_gene_variant ; 571.0bp to feature; MODIFIER | silent_mutation | Average:12.056; most accessible tissue: Callus, score: 49.554 | N | N | N | N |
| vg0208608994 | C -> T | LOC_Os02g15410.1 | downstream_gene_variant ; 3365.0bp to feature; MODIFIER | silent_mutation | Average:12.056; most accessible tissue: Callus, score: 49.554 | N | N | N | N |
| vg0208608994 | C -> T | LOC_Os02g15390-LOC_Os02g15400 | intergenic_region ; MODIFIER | silent_mutation | Average:12.056; most accessible tissue: Callus, score: 49.554 | N | N | N | N |
| vg0208608994 | C -> DEL | N | N | silent_mutation | Average:12.056; most accessible tissue: Callus, score: 49.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208608994 | 4.42E-06 | 4.43E-06 | mr1160 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | 6.39E-06 | NA | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | NA | 1.33E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | NA | 5.83E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | NA | 2.56E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | 2.12E-06 | NA | mr1590 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | 5.32E-06 | NA | mr1623 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | 4.92E-06 | NA | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | NA | 5.82E-06 | mr1755 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | NA | 5.62E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208608994 | 5.62E-06 | 5.62E-06 | mr1827 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |