\
| Variant ID: vg0208464517 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8464517 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.28, others allele: 0.00, population size: 82. )
AAATATAAAATATAATCAAGTATTTTACTATTATAATCCAAATAAATTGATTCAAAATAGTTTTAAAAAAATCAATAGGCAAGTTATATAGTCAATAAAC[T/A]
GTAAGAAGGCTTATGACATGGAAAAATTACATACACCAATATGCTTTATTGTCCGGTATATTTTACAAGACAACAAAGTTATAAGTATGTCATTTAAAAA
TTTTTAAATGACATACTTATAACTTTGTTGTCTTGTAAAATATACCGGACAATAAAGCATATTGGTGTATGTAATTTTTCCATGTCATAAGCCTTCTTAC[A/T]
GTTTATTGACTATATAACTTGCCTATTGATTTTTTTAAAACTATTTTGAATCAATTTATTTGGATTATAATAGTAAAATACTTGATTATATTTTATATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 16.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 82.80% | 17.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 83.80% | 16.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.50% | 36.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208464517 | T -> A | LOC_Os02g15178.1 | upstream_gene_variant ; 3853.0bp to feature; MODIFIER | silent_mutation | Average:19.044; most accessible tissue: Callus, score: 39.88 | N | N | N | N |
| vg0208464517 | T -> A | LOC_Os02g15169.1 | upstream_gene_variant ; 518.0bp to feature; MODIFIER | silent_mutation | Average:19.044; most accessible tissue: Callus, score: 39.88 | N | N | N | N |
| vg0208464517 | T -> A | LOC_Os02g15178-LOC_Os02g15169 | intergenic_region ; MODIFIER | silent_mutation | Average:19.044; most accessible tissue: Callus, score: 39.88 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208464517 | NA | 1.19E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208464517 | NA | 1.92E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208464517 | NA | 1.69E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208464517 | NA | 2.16E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208464517 | NA | 1.36E-08 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208464517 | 1.07E-07 | NA | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208464517 | NA | 1.13E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |