Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0208366317:

Variant ID: vg0208366317 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8366317
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTAATACTCAGGCACCGAGTCTAATATGTATAGGTATCGGGTCTGATAATTAGATACCGAGTTTGATATATAGAAGTATCGGGTCTGAGACTCAGGTA[T/C]
TGGTTACCTGATTTCATACATATAGGTATCGGGTCAAGAAGAAAAAAATATGATGTGTGCCACATGATTACTACTGTGCTAATATACTTTTCTTGTTCCA

Reverse complement sequence

TGGAACAAGAAAAGTATATTAGCACAGTAGTAATCATGTGGCACACATCATATTTTTTTCTTCTTGACCCGATACCTATATGTATGAAATCAGGTAACCA[A/G]
TACCTGAGTCTCAGACCCGATACTTCTATATATCAAACTCGGTATCTAATTATCAGACCCGATACCTATACATATTAGACTCGGTGCCTGAGTATTAGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	0.20%	0.19%	16.34%	NA
All Indica	2759	84.00%	0.30%	0.25%	15.48%	NA
All Japonica	1512	79.20%	0.10%	0.13%	20.50%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	62.90%	0.50%	0.50%	36.13%	NA
Indica II	465	94.60%	0.20%	0.00%	5.16%	NA
Indica III	913	90.40%	0.10%	0.11%	9.42%	NA
Indica Intermediate	786	86.40%	0.30%	0.38%	12.98%	NA
Temperate Japonica	767	97.50%	0.00%	0.00%	2.48%	NA
Tropical Japonica	504	44.80%	0.40%	0.40%	54.37%	NA
Japonica Intermediate	241	92.90%	0.00%	0.00%	7.05%	NA
VI/Aromatic	96	72.90%	1.00%	0.00%	26.04%	NA
Intermediate	90	88.90%	0.00%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208366317	T -> DEL	N	N	silent_mutation	Average:70.727; most accessible tissue: Callus, score: 85.406	N	N	N	N
vg0208366317	T -> C	LOC_Os02g14990.1	upstream_gene_variant ; 2413.0bp to feature; MODIFIER	silent_mutation	Average:70.727; most accessible tissue: Callus, score: 85.406	N	N	N	N
vg0208366317	T -> C	LOC_Os02g14980.1	downstream_gene_variant ; 3357.0bp to feature; MODIFIER	silent_mutation	Average:70.727; most accessible tissue: Callus, score: 85.406	N	N	N	N
vg0208366317	T -> C	LOC_Os02g15000.1	downstream_gene_variant ; 905.0bp to feature; MODIFIER	silent_mutation	Average:70.727; most accessible tissue: Callus, score: 85.406	N	N	N	N
vg0208366317	T -> C	LOC_Os02g14980.2	downstream_gene_variant ; 3358.0bp to feature; MODIFIER	silent_mutation	Average:70.727; most accessible tissue: Callus, score: 85.406	N	N	N	N
vg0208366317	T -> C	LOC_Os02g14990-LOC_Os02g15000	intergenic_region ; MODIFIER	silent_mutation	Average:70.727; most accessible tissue: Callus, score: 85.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208366317	7.64E-07	6.22E-08	mr1174_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208366317	NA	9.40E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208366317	NA	3.60E-08	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251