\
| Variant ID: vg0208287795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8287795 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGTCATGCAAGCCAATACCGCTGGCACGTAATCATTTACATGACAAAATCACCTACAAAACTATGGTAGGGGTTATTTGAACCGGTTTTCATACTTCAG[G/T]
GGTAGAATATCCGGTTTCGTCCTTTACGGAGTTAAGTAAACCAATCCCAATACTTCGGGAGTTACTAGCAATTGTAGCCTTAAAAATCTCGAACTCTACT
AGTAGAGTTCGAGATTTTTAAGGCTACAATTGCTAGTAACTCCCGAAGTATTGGGATTGGTTTACTTAACTCCGTAAAGGACGAAACCGGATATTCTACC[C/A]
CTGAAGTATGAAAACCGGTTCAAATAACCCCTACCATAGTTTTGTAGGTGATTTTGTCATGTAAATGATTACGTGCCAGCGGTATTGGCTTGCATGACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 0.70% | 0.72% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.50% | 2.20% | 2.25% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.70% | 4.40% | 3.91% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208287795 | G -> T | LOC_Os02g14890.1 | upstream_gene_variant ; 4677.0bp to feature; MODIFIER | silent_mutation | Average:39.022; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0208287795 | G -> T | LOC_Os02g14880.1 | downstream_gene_variant ; 1507.0bp to feature; MODIFIER | silent_mutation | Average:39.022; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0208287795 | G -> T | LOC_Os02g14874-LOC_Os02g14880 | intergenic_region ; MODIFIER | silent_mutation | Average:39.022; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208287795 | 4.58E-06 | NA | mr1238 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 6.76E-07 | NA | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 4.77E-06 | NA | mr1484 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 6.53E-07 | NA | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 1.17E-06 | NA | mr1238_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 6.51E-06 | 6.51E-06 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 7.37E-07 | NA | mr1841_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 4.71E-07 | NA | mr1900_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208287795 | 1.37E-06 | 1.37E-06 | mr1945_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |