\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208287795:

Variant ID: vg0208287795 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8287795
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTCATGCAAGCCAATACCGCTGGCACGTAATCATTTACATGACAAAATCACCTACAAAACTATGGTAGGGGTTATTTGAACCGGTTTTCATACTTCAG[G/T]
GGTAGAATATCCGGTTTCGTCCTTTACGGAGTTAAGTAAACCAATCCCAATACTTCGGGAGTTACTAGCAATTGTAGCCTTAAAAATCTCGAACTCTACT

Reverse complement sequence

AGTAGAGTTCGAGATTTTTAAGGCTACAATTGCTAGTAACTCCCGAAGTATTGGGATTGGTTTACTTAACTCCGTAAAGGACGAAACCGGATATTCTACC[C/A]
CTGAAGTATGAAAACCGGTTCAAATAACCCCTACCATAGTTTTGTAGGTGATTTTGTCATGTAAATGATTACGTGCCAGCGGTATTGGCTTGCATGACAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 0.70% 0.72% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 95.50% 2.20% 2.25% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 91.70% 4.40% 3.91% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208287795 G -> T LOC_Os02g14890.1 upstream_gene_variant ; 4677.0bp to feature; MODIFIER silent_mutation Average:39.022; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0208287795 G -> T LOC_Os02g14880.1 downstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:39.022; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0208287795 G -> T LOC_Os02g14874-LOC_Os02g14880 intergenic_region ; MODIFIER silent_mutation Average:39.022; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208287795 4.58E-06 NA mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 6.76E-07 NA mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 4.77E-06 NA mr1484 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 6.53E-07 NA mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 1.17E-06 NA mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 6.51E-06 6.51E-06 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 7.37E-07 NA mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 4.71E-07 NA mr1900_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287795 1.37E-06 1.37E-06 mr1945_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251