\
| Variant ID: vg0208279406 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8279406 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 89. )
TAAAGAATATTTGATTATAAATGAAGTCATAATAAAATAAATGATAATTACATAAATTTTTTGAATAAGACGAAAGGTCAAACGTTTATCAAAAGGTCAA[C/T]
GGCGTCATACATTAAAATACAGATGGGGTATATATTATCTAATTTTAGATGCATAGCACTTAAACTTACTATAGCAGTTAAACATACTAAGGTTCTGAGG
CCTCAGAACCTTAGTATGTTTAACTGCTATAGTAAGTTTAAGTGCTATGCATCTAAAATTAGATAATATATACCCCATCTGTATTTTAATGTATGACGCC[G/A]
TTGACCTTTTGATAAACGTTTGACCTTTCGTCTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTATGACTTCATTTATAATCAAATATTCTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 36.50% | 0.51% | 21.71% | NA |
| All Indica | 2759 | 29.90% | 47.90% | 0.51% | 21.67% | NA |
| All Japonica | 1512 | 71.30% | 3.00% | 0.40% | 25.33% | NA |
| Aus | 269 | 0.00% | 99.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 23.00% | 38.20% | 1.18% | 37.65% | NA |
| Indica II | 465 | 25.80% | 66.90% | 0.22% | 7.10% | NA |
| Indica III | 913 | 37.20% | 44.80% | 0.11% | 17.85% | NA |
| Indica Intermediate | 786 | 29.10% | 47.60% | 0.64% | 22.65% | NA |
| Temperate Japonica | 767 | 94.40% | 1.80% | 0.13% | 3.65% | NA |
| Tropical Japonica | 504 | 37.50% | 4.00% | 0.60% | 57.94% | NA |
| Japonica Intermediate | 241 | 68.50% | 4.60% | 0.83% | 26.14% | NA |
| VI/Aromatic | 96 | 6.20% | 59.40% | 1.04% | 33.33% | NA |
| Intermediate | 90 | 44.40% | 38.90% | 3.33% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208279406 | C -> T | LOC_Os02g14874.1 | downstream_gene_variant ; 903.0bp to feature; MODIFIER | silent_mutation | Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0208279406 | C -> T | LOC_Os02g14874.2 | downstream_gene_variant ; 993.0bp to feature; MODIFIER | silent_mutation | Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0208279406 | C -> T | LOC_Os02g14874-LOC_Os02g14880 | intergenic_region ; MODIFIER | silent_mutation | Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0208279406 | C -> DEL | N | N | silent_mutation | Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208279406 | NA | 2.89E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 1.45E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 3.41E-07 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 9.06E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 1.66E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 3.41E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 4.53E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 6.39E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 9.96E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 1.67E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 3.72E-19 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 1.81E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 1.60E-15 | mr1921 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208279406 | NA | 2.67E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |