\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208279406:

Variant ID: vg0208279406 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8279406
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGAATATTTGATTATAAATGAAGTCATAATAAAATAAATGATAATTACATAAATTTTTTGAATAAGACGAAAGGTCAAACGTTTATCAAAAGGTCAA[C/T]
GGCGTCATACATTAAAATACAGATGGGGTATATATTATCTAATTTTAGATGCATAGCACTTAAACTTACTATAGCAGTTAAACATACTAAGGTTCTGAGG

Reverse complement sequence

CCTCAGAACCTTAGTATGTTTAACTGCTATAGTAAGTTTAAGTGCTATGCATCTAAAATTAGATAATATATACCCCATCTGTATTTTAATGTATGACGCC[G/A]
TTGACCTTTTGATAAACGTTTGACCTTTCGTCTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTATGACTTCATTTATAATCAAATATTCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 36.50% 0.51% 21.71% NA
All Indica  2759 29.90% 47.90% 0.51% 21.67% NA
All Japonica  1512 71.30% 3.00% 0.40% 25.33% NA
Aus  269 0.00% 99.60% 0.00% 0.37% NA
Indica I  595 23.00% 38.20% 1.18% 37.65% NA
Indica II  465 25.80% 66.90% 0.22% 7.10% NA
Indica III  913 37.20% 44.80% 0.11% 17.85% NA
Indica Intermediate  786 29.10% 47.60% 0.64% 22.65% NA
Temperate Japonica  767 94.40% 1.80% 0.13% 3.65% NA
Tropical Japonica  504 37.50% 4.00% 0.60% 57.94% NA
Japonica Intermediate  241 68.50% 4.60% 0.83% 26.14% NA
VI/Aromatic  96 6.20% 59.40% 1.04% 33.33% NA
Intermediate  90 44.40% 38.90% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208279406 C -> T LOC_Os02g14874.1 downstream_gene_variant ; 903.0bp to feature; MODIFIER silent_mutation Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0208279406 C -> T LOC_Os02g14874.2 downstream_gene_variant ; 993.0bp to feature; MODIFIER silent_mutation Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0208279406 C -> T LOC_Os02g14874-LOC_Os02g14880 intergenic_region ; MODIFIER silent_mutation Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0208279406 C -> DEL N N silent_mutation Average:32.803; most accessible tissue: Minghui63 root, score: 65.927 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208279406 NA 2.89E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 1.45E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 3.41E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 9.06E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 1.66E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 3.41E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 4.53E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 6.39E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 9.96E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 1.67E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 3.72E-19 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 1.81E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 1.60E-15 mr1921 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208279406 NA 2.67E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251