Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208223979:

Variant ID: vg0208223979 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8223979
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAGACGATGATCGCTGATGAAAAATAACTATTTTGTAGATTCTTTTTTTTATGGATGTGTGTTGTTTCTCATGACAAGGAATGCGAGTTAAATTTTAA[T/C]
TTATCGTAAACTGGTATGAGTAGATGAAAAACTTTGAGACATTAGGCGGTGGTGGCGATGTGTGACGTAATACAAACTTTATTATTAGAATTTTATTGTT

Reverse complement sequence

AACAATAAAATTCTAATAATAAAGTTTGTATTACGTCACACATCGCCACCACCGCCTAATGTCTCAAAGTTTTTCATCTACTCATACCAGTTTACGATAA[A/G]
TTAAAATTTAACTCGCATTCCTTGTCATGAGAAACAACACACATCCATAAAAAAAAGAATCTACAAAATAGTTATTTTTCATCAGCGATCATCGTCTACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 25.40% 10.41% 3.32% NA
All Indica  2759 85.70% 4.70% 8.12% 1.52% NA
All Japonica  1512 22.60% 68.70% 5.75% 2.98% NA
Aus  269 24.20% 0.00% 54.65% 21.19% NA
Indica I  595 70.90% 7.70% 19.16% 2.18% NA
Indica II  465 94.60% 1.90% 2.80% 0.65% NA
Indica III  913 90.50% 4.90% 3.50% 1.10% NA
Indica Intermediate  786 86.00% 3.70% 8.27% 2.04% NA
Temperate Japonica  767 2.90% 95.40% 1.04% 0.65% NA
Tropical Japonica  504 52.60% 27.60% 13.29% 6.55% NA
Japonica Intermediate  241 22.80% 69.30% 4.98% 2.90% NA
VI/Aromatic  96 62.50% 3.10% 25.00% 9.38% NA
Intermediate  90 52.20% 32.20% 11.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208223979 T -> DEL N N silent_mutation Average:11.286; most accessible tissue: Callus, score: 56.671 N N N N
vg0208223979 T -> C LOC_Os02g14810.1 downstream_gene_variant ; 3877.0bp to feature; MODIFIER silent_mutation Average:11.286; most accessible tissue: Callus, score: 56.671 N N N N
vg0208223979 T -> C LOC_Os02g14800.5 downstream_gene_variant ; 623.0bp to feature; MODIFIER silent_mutation Average:11.286; most accessible tissue: Callus, score: 56.671 N N N N
vg0208223979 T -> C LOC_Os02g14800.3 downstream_gene_variant ; 739.0bp to feature; MODIFIER silent_mutation Average:11.286; most accessible tissue: Callus, score: 56.671 N N N N
vg0208223979 T -> C LOC_Os02g14800-LOC_Os02g14810 intergenic_region ; MODIFIER silent_mutation Average:11.286; most accessible tissue: Callus, score: 56.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208223979 NA 2.91E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 3.39E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 8.52E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 4.30E-19 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 8.80E-06 mr1557 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 5.02E-11 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 1.98E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 1.30E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 4.03E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 3.01E-12 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 1.13E-06 NA mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 1.05E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979 NA 1.87E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251