Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0208223979:

Variant ID: vg0208223979 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8223979
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTAGACGATGATCGCTGATGAAAAATAACTATTTTGTAGATTCTTTTTTTTATGGATGTGTGTTGTTTCTCATGACAAGGAATGCGAGTTAAATTTTAA[T/C]
TTATCGTAAACTGGTATGAGTAGATGAAAAACTTTGAGACATTAGGCGGTGGTGGCGATGTGTGACGTAATACAAACTTTATTATTAGAATTTTATTGTT

Reverse complement sequence

AACAATAAAATTCTAATAATAAAGTTTGTATTACGTCACACATCGCCACCACCGCCTAATGTCTCAAAGTTTTTCATCTACTCATACCAGTTTACGATAA[A/G]
TTAAAATTTAACTCGCATTCCTTGTCATGAGAAACAACACACATCCATAAAAAAAAGAATCTACAAAATAGTTATTTTTCATCAGCGATCATCGTCTACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	25.40%	10.41%	3.32%	NA
All Indica	2759	85.70%	4.70%	8.12%	1.52%	NA
All Japonica	1512	22.60%	68.70%	5.75%	2.98%	NA
Aus	269	24.20%	0.00%	54.65%	21.19%	NA
Indica I	595	70.90%	7.70%	19.16%	2.18%	NA
Indica II	465	94.60%	1.90%	2.80%	0.65%	NA
Indica III	913	90.50%	4.90%	3.50%	1.10%	NA
Indica Intermediate	786	86.00%	3.70%	8.27%	2.04%	NA
Temperate Japonica	767	2.90%	95.40%	1.04%	0.65%	NA
Tropical Japonica	504	52.60%	27.60%	13.29%	6.55%	NA
Japonica Intermediate	241	22.80%	69.30%	4.98%	2.90%	NA
VI/Aromatic	96	62.50%	3.10%	25.00%	9.38%	NA
Intermediate	90	52.20%	32.20%	11.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208223979	T -> DEL	N	N	silent_mutation	Average:11.286; most accessible tissue: Callus, score: 56.671	N	N	N	N
vg0208223979	T -> C	LOC_Os02g14810.1	downstream_gene_variant ; 3877.0bp to feature; MODIFIER	silent_mutation	Average:11.286; most accessible tissue: Callus, score: 56.671	N	N	N	N
vg0208223979	T -> C	LOC_Os02g14800.5	downstream_gene_variant ; 623.0bp to feature; MODIFIER	silent_mutation	Average:11.286; most accessible tissue: Callus, score: 56.671	N	N	N	N
vg0208223979	T -> C	LOC_Os02g14800.3	downstream_gene_variant ; 739.0bp to feature; MODIFIER	silent_mutation	Average:11.286; most accessible tissue: Callus, score: 56.671	N	N	N	N
vg0208223979	T -> C	LOC_Os02g14800-LOC_Os02g14810	intergenic_region ; MODIFIER	silent_mutation	Average:11.286; most accessible tissue: Callus, score: 56.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208223979	NA	2.91E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	3.39E-07	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	8.52E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	4.30E-19	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	8.80E-06	mr1557	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	5.02E-11	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	1.98E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	1.30E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	4.03E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	3.01E-12	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	1.13E-06	NA	mr1718_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	1.05E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208223979	NA	1.87E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251