Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0208194726:

Variant ID: vg0208194726 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8194726
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.07, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

GACCGTCCGTCTTATTTGAAAAAAAATATGAAAAAAATTAAAAAGACAAGTCACGCATAAAATATTAATTATGTTTTATCATCTAACAACAATGAAAATA[C/T,G]
GAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTGGACACGGAAACCCATGGTTTATTTTTTTTTTTAGGACGGAGGGAGTATGGTTTAAGCT

Reverse complement sequence

AGCTTAAACCATACTCCCTCCGTCCTAAAAAAAAAAATAAACCATGGGTTTCCGTGTCCAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTC[G/A,C]
TATTTTCATTGTTGTTAGATGATAAAACATAATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTCATATTTTTTTTCAAATAAGACGGACGGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	13.10%	1.67%	11.38%	G: 0.06%
All Indica	2759	73.40%	13.20%	1.38%	11.92%	G: 0.11%
All Japonica	1512	70.20%	14.70%	2.51%	12.50%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	68.60%	13.10%	2.02%	16.30%	NA
Indica II	465	87.30%	5.80%	0.43%	6.45%	NA
Indica III	913	68.30%	18.80%	1.20%	11.61%	NA
Indica Intermediate	786	74.80%	10.90%	1.65%	12.21%	G: 0.38%
Temperate Japonica	767	96.10%	0.90%	0.52%	2.48%	NA
Tropical Japonica	504	29.80%	36.10%	6.35%	27.78%	NA
Japonica Intermediate	241	72.60%	14.10%	0.83%	12.45%	NA
VI/Aromatic	96	61.50%	22.90%	2.08%	13.54%	NA
Intermediate	90	83.30%	7.80%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208194726	C -> G	LOC_Os02g14780.1	upstream_gene_variant ; 2169.0bp to feature; MODIFIER	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N
vg0208194726	C -> G	LOC_Os02g14780.2	upstream_gene_variant ; 2169.0bp to feature; MODIFIER	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N
vg0208194726	C -> G	LOC_Os02g14770-LOC_Os02g14780	intergenic_region ; MODIFIER	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N
vg0208194726	C -> T	LOC_Os02g14780.1	upstream_gene_variant ; 2169.0bp to feature; MODIFIER	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N
vg0208194726	C -> T	LOC_Os02g14780.2	upstream_gene_variant ; 2169.0bp to feature; MODIFIER	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N
vg0208194726	C -> T	LOC_Os02g14770-LOC_Os02g14780	intergenic_region ; MODIFIER	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N
vg0208194726	C -> DEL	N	N	silent_mutation	Average:41.72; most accessible tissue: Minghui63 root, score: 66.549	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208194726	8.48E-06	8.48E-06	mr1566	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251